Labshake search
Citations for Promega :
701 - 750 of 2066 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 µg plasmid was combined with 3 µl FuGENE (Promega, E2311) in OptiMEM medium for each ml of culture medium ...
-
bioRxiv - Cancer Biology 2024Quote: Caspase activity was measured using Caspase-Glo® 3/7 (Promega) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: Apoptosis was measured using the Caspase-Glo 3/7 Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... Sorted nuclei were collected in 5-ml tubes containing 300-500 μl of collection buffer (PBS + 5% BSA) and RNasin Plus RNase inhibitor (Promega). Sorted nuclei were collected by centrifuging at 500g for 10 min at 4°C and processed for downstream analyses (RNA-seq ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ng renilla control reporter vector (Promega), mock luciferase ...
-
bioRxiv - Genomics 2024Quote: ... lysed by a 5× reporter lysis buffer (Promega) and incubated overnight at −20°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Microbiology 2020Quote: ... each reaction contained 20 μL of 100 ng of pGL3 plasmid (Promega), mixed with 100 ng Igf2 P3 Nluc (or empty vector or constructs obtained from Igf2 P3 Nluc) ...
-
bioRxiv - Cell Biology 2020Quote: ... and lysed in 20 μl of 1x passive lysis buffer (PLB) (Promega) for downstream analysis ...
-
bioRxiv - Cancer Biology 2022Quote: ... CellTiter 96 Aqueous One Solution MTS Reagent (20 μL, Promega Cat# G3582) was added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Amplicons (20) under each condition were subcloned in pGEM-T Easy (Promega) and sequenced (Multi-Disciplinary Laboratories Unit ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20 µL of resazurin (CellTiter-Blue® Cell Viability Assay kit – Promega) were added to perform the viability assay ...
-
bioRxiv - Neuroscience 2021Quote: ... Heads (10/sample) were homogenized in 20 μL Glo Lysis buffer (Promega), incubated at room temperature for 15 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by digestion in 20 μl of 10ng ul-1 Trypsin (Promega) in 25 mM NH4HCO3 (pH 8.0-8.5 ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were placed in 20% Nano-Glo® Live Cell Reagent (Promega) mixed with 80% DMEM containing 1% FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 µl of Cell Titer Blue® reagent (Promega, Madison, WI, USA) was added to the cells and incubated for 4 h at 37 ºC ...
-
bioRxiv - Genetics 2024Quote: ... in 2x SSCT (0.1% Tween-20 in 2x SSC (Promega, Cat# V4261)) for 5 min at RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μl (20 ng/μl) of modified sequencing-grade trypsin (Promega, V5111) was spiked into the solutions and the samples were incubated at 37 °C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 1:20 of the extended live cell substrate EndurazineTM (Promega) was added to each well ...
-
bioRxiv - Biochemistry 2022Quote: ... 20 μL of MTS solution (CellTiter 96 Aqueous One solution reagent, Promega) was added to each well ...
-
bioRxiv - Plant Biology 2022Quote: ... and 10 units T4 DNA ligase (HC, 20 units μl−1, Promega). In a thermocycler ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10 µl of a mix of LgBiT (1:20 dilution; #N2421, Promega) and furimazine (1:10 dilution ...
-
bioRxiv - Genomics 2023Quote: ... 20 μl of Proteinase K (Promega Wizard HMW DNA Extraction Kit A2920) was added and the samples mixed by inverting 10 times and incubated 15 minutes at 56°C followed by chilling on ice for 1 minute ...
-
bioRxiv - Microbiology 2024Quote: ... proteinase K (50µg/ml) and 0.5% tween 20 solution] (Promega corporation, USA) for 2 hour at 55°C after vortexing thoroughly and placed in a heat block (DAIHA Scientific ...
-
bioRxiv - Systems Biology 2024Quote: ... proteins were digested with trypsin (Sequencing Grade Modified Trypsin, 20 μg, Promega) at an enzyme-to-protein ratio of 1:50 in 20 mM ABC ...
-
bioRxiv - Biophysics 2024Quote: ... the cells were permeabilized in 0.5% (v/v) Tween 20 (H5152, Promega) in PBS three times for 5 minutes at RT ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... extracted from 5 HPVL and 5 LPVL (Table S3, Petersen et al., 2021) were treated with the DNase RQ1 (Promega, US). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... 1,3 μg of plasmid DNA and 3 μl of FuGene 6 (Promega) were mixed in 100 µl Opti-MEMTM medium before the addition to the dish ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was co-transfected with 3 ng phRG-TK Renilla vector (Promega) as normalization control ...
-
bioRxiv - Molecular Biology 2021Quote: ... transfected with 1 µg DNA and 3 µl FuGENE HD (Promega, E2311) in 150 µl Opti-MEM media according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5µg was analyzed using the Caspase 3/7 glo kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and caspase activity was measured by Caspase-Glo 3/7(Promega, G8092).