Labshake search
Citations for Promega :
651 - 700 of 1258 citations for S 3 Amino 4 4 cyanophenyl butanoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Total nucleic acid was then treated with DNase I as recommended (20 units; Promega), re-extracted with phenol/Sevag ...
-
bioRxiv - Pathology 2023Quote: ... and amniotic fluid using the Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... using either the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega, AS1330) or the Maxwell® RSC miRNA from the Tissue and Plasma or Serum Kit (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... The nucleic acid pellets were resuspended in water and treated with DNAse (RQ1, Promega) for one hour at 37 ºC according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... SYBR Green I nucleic acid gel stain and Go Taq Hot Start Polymerase (Promega). qRT-PCRs were carried out in a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2022Quote: ... and amniotic fluid using the Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Bioengineering 2022Quote: Induction of apoptosis after 24 h of doxorubicin treatment was quantified by analyzing Caspase 3/7 activity using the Caspase-Glo® 3/7 3D assay (Promega, Madison, WI). The assay protocol was followed from the manufacturer’s website ...
-
bioRxiv - Immunology 2024Quote: ... 5-GGATCCACACGGTGCAAAGAGAGACCC-3’ and 5′-TCGGCCTTTCAGACTAATCTTATCAGC-3’ The PCR products were gel purified and cloned into the pGEM-T vector (Promega; Madison, WI, USA). The inserted PCR fragments of individual clones were sequenced by Tsing KE Biological Technology ...
-
bioRxiv - Cell Biology 2024Quote: Apoptosis was assessed by measuring caspase 3/7 activity using a Caspase-Glo 3/7 Assay Kit (Promega, Southampton, UK, Cat. No. G8091), according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: The Cyp4p1 gene was amplified from the Canton-S antennal cDNA with primers ATGATTATCTTGTGGCTGATTCTG and AATAAGTCACGTTCGCCTCAC and then ligated into pGEM-T Easy (Promega). The vector carrying the full length Cyp4p1 insert was verified by restriction digests and sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product (2.0 kb) was purified using S-400 HR columns (GE, UK) and cloned in pGEM T-Easy system (Promega, USA) according to the manufacturer instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... NY) and washed with S-Trap buffer prior to overnight proteolysis at 37°C with LysC/trypsin (Promega, Madison, WI) in 50 mM ammonium bicarbonate (pH 8.0 ...
-
bioRxiv - Microbiology 2022Quote: ... and the Gaussia princeps luciferase enzymatic activity was measured on a Centro XS LB960 microplate luminometer (Berthold Technologies, reading time 10 s after injection of 50 µl Renilla luciferase reagent (Promega). For the minigenome assays ...
-
bioRxiv - Cancer Biology 2022Quote: GSH/GSSG measurement was performed by a glutathione S-transferase (GST) enzyme coupled reaction using (GSH/GSSG Glo kit, Promega). Cells (2×104 ...
-
bioRxiv - Microbiology 2022Quote: Flag-Trim69 was cloned downstream of a gluthathione-S-transferase (GST) in the pTKPL vector (an in-house derivative of the vector pGEXTK, Promega) and purified from bacterial lysates on glutathione agarose beads (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... princeps luciferase enzymatic activity due to luciferase reconstitution was measured on a Centro XS LB960 microplate luminometer (Berthold Technologies) using a reading time of 10 s after injection of 50 µl Renilla luciferase reagent (Promega). Mean relative light units (RLUs ...
-
bioRxiv - Microbiology 2022Quote: ... Germany) for 2.5 s by adding 20 μL of Nano-Glo® substrate in assay buffer (Promega Inc, WI, USA). Uninfected monolayer of Vero cells treated identically served as controls to determine basal luciferase activity for obtaining normalized relative light units ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... luminescence photons were collected by accumulating the image for 60 s in the presence of 2 mM D-luciferin (Promega), and the luminescence signal was measured from the same varicosities as the corresponding fluorescence image ...
-
bioRxiv - Cancer Biology 2023Quote: ... samples resuspended in 5%SDS buffer were reduced with DTT and alkylated, followed by digestion on a S-Trap column (ProtiFi, LLC)with sequencing-grade Lys-C/trypsin (Promega). The resulting peptides were were analyzed with a nanoAcquity UPLC system (Waters ...
-
bioRxiv - Biochemistry 2024Quote: ... S-trap columns containing the bound sample proteins were digested with sequencing grade modified trypsin (Promega, Fitchburg, WI, Cat # V5111). Upon completion of digestion ...
-
bioRxiv - Immunology 2022Quote: ... vRNA was isolated from plasma using the Maxwell Viral Total Nucleic Acid Purification kit (Promega) on a Maxwell 48 RSC instrument (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... viral RNA was extracted using the Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega), subjected to DNAse treatment using TURBO DNAse (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: Maxwell® RSC Viral Total Nucleic Acid Purification Kit (cat. # ASB1330, Promega Corporation, Madison, WI) was used for RNA isolation ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted using the Maxwell® RSC Viral Total Nucleic Acid Purification kit (Promega), as per the manufacturer’s instructions into nuclease-free water ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were precipitated with trichloroacetic acid and digested with Lys-C (Wako) and trypsin (Promega). The peptides were then analysed using an Ultimate 3000 nano-RSLC (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then placed in a 50 mL solution of 1 ×Diamond Nucleic Acid Dye (Promega) in 0.2 ×TBE buffer pH 7.6 to rock in the dark for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... nucleic acids were purified separately using the Maxwell RSC simplyRNA Cells Kit (Promega, AS 1390) and Maxwell RSC Blood DNA Kit (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was measured 3 days later using CellTiterGlo (Promega).
-
bioRxiv - Microbiology 2021Quote: ... in a 3:1 ratio of FuGENE®HD (Promega) transfection reagent to DNA ...
-
bioRxiv - Immunology 2020Quote: ... the protein suspension was digested with 3 μg trypsin (Promega) in 40 μl 25 mM NH4HCO3 overnight at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... (3) we used ProNex Size-Selection DNA purification System (Promega) for purification of PCR product ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was assessed with Caspase-Glo 3/7 assay (Promega) according to the manufacturer’s instruction.
-
bioRxiv - Genetics 2021Quote: ... and Caspase-Glo® 3/7 Assay System (Promega, G8090), respectively ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... followed by 3 h at 37°C using trypsin (Promega). All proteolytic digests were acidified to pH 2 by addition of 10% formic acid and directly analyzed by LC-ESI-MS/MS ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-3 µg bacmid DNA was transfected (FuGene HD, Promega) into 2 ml Sf9 cells plated at 0.5x106 cells/ml density in a 6-well plate and left to incubate for 5-7 days 27ºC without shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... in combination with Caspase-Glo® 3/7 Reagent (Promega) [33] ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... we utilized BetaFluor β-gal assay kit (Promega 70979-3) to distinguish between Kif17+/- and Kif17-/- littermates at postnatal day 8 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The caspase 3/7 Glo assay (Promega, Madison, WI, USA) was performed on the white plates according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... the permeabilization protocol used a 3 minute 0,02% digitonin (Promega) exposure ...
-
bioRxiv - Cell Biology 2022Quote: ... and caspase-3/7 assay (Cat # G8090, Promega, Madison, WI) were performed using commercially available kits as per the instructions to assess proliferation and apoptosis ...
-
bioRxiv - Cancer Biology 2023Quote: ... after which 3 μL of CellTiter-Glo reagent (Promega, G7572) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were embedded in 3% low melting point agar (Promega). Formalin embedding ...
-
bioRxiv - Cancer Biology 2023Quote: Apoptosis was measured by luminescent caspase 3/7 assay (Promega). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µl of nuclease free water (Promega, Cat No. P119E), and 5 µl of cDNA using the following program ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Caspase 3/7 activity by Caspase-Glo (#G8093, Promega). Plates were read on a SpectraMax I3 plate reader ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the Caspase-Glo® 3/7 Assay kit (Promega), following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... with the Caspase-Glo 3/7 Assay System (Promega, G8090). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... import assays of the comparatively higher molecular weight ACE2 and S proteins (50 μL reactions) were both performed using the TNT® Coupled Transcription/ Translation system (Promega) for 90 min at 30°C as described by the manufacturer (∼50 ng/μL cDNA,1 μM Ipom-F or an equivalent volume of DMSO ...
-
bioRxiv - Plant Biology 2022Quote: ... according to manufacturer’s instruction with on-column DNase digestion using 60 μL of DNase mixture (15 μL RQ1 RNase-Free DNase (Promega, M6101), 6 μL RQ1 DNase 10X Reaction Buffer and 19 μL nuclease-free water ...