Labshake search
Citations for Promega :
651 - 700 of 3891 citations for Rat Aflatoxin B1 Aldehyde Reductase Member 3 AKR7A3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Select colonies were then grown in 3 ml of LB with appropriate antibiotics and the plasmids were purified with PureYield Plasmid Miniprep System (Promega), performing restriction enzyme digests to verify that the plasmids had inserts.
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2022Quote: ... The transfected neurons were stimulated with 200μM glycine for 3 min and then washed for 30 minutes before lysis in 100 μl of buffer for dual luciferase assay (Promega). 20 μl of the lysates were used for the quantification of Firefly and Renilla Luciferase activity using a Luminometer (GloMax ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were cultured for 3 days and cell viability was measured using CellTiter-Glo® 3D Cell viability assay (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed for the splicing analysis with the 3 µl of cDNA in a total volume of 20 µl with GoTaq Polymerase 2X (Promega) and 32 amplification cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and mutant Shank2 and Mdga1 3′ UTR luciferase constructs were generated by standard cloning procedures into pmiRGLO dual-luciferase expression vector (Promega). First ...
-
bioRxiv - Cell Biology 2023Quote: The Human SART1 mutant resistant to siSART1#3 and its deletions mutants (amplified by PCR) were subcloned into pCI-neo Mammalian Expression Vector (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... was added to 3 of the wells per treatment condition and 50 µL Oxidized Glutathione Lysis Reagent (Promega Cat #TM344) was added to the other 3 wells per treatment condition ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PC-3 cell line was authenticated by Macrogen (Korea) using short tandem repeat (STR) profiling (Powerplex 21 System, Promega). All cell lines tested negative for mycoplasma contamination using the Microsart AMP Mycoplasma Kit (Sartorius).
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Genomics 2021Quote: ... was extracted from tissue samples using a commercial kit (Wizard R Genomic DNA Purification Kit, Promega) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... pGEM®-T kit from Promega were used ...
-
bioRxiv - Immunology 2019Quote: ... using a luciferase assay kit (Promega). Results were normalized to β-galactosidase activity (Galactostar ...
-
Proteomics of broad deubiquitylase inhibition unmasks redundant enzyme function to reveal substratesbioRxiv - Biochemistry 2020Quote: ... with the TNT kit (Promega: L1770). Each substrate was amplified with primers by PCR to allow T7-dependent transcription of the PCR product or transcribed directly if plasmids contained a T7 promoter ...
-
bioRxiv - Microbiology 2019Quote: A Luciferase Assay System kit (Promega) was used ...
-
bioRxiv - Plant Biology 2019Quote: The Reverse Transcription System Kit (Promega) was used to synthesize a cDNA library following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... or Luciferase Assay System kit (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2020Quote: ... the PureYield™ MidiPrep Kit (ProMega) and NucleoBond Xtra™ Midi/Maxi Kit (Macherey & Nagel ...
-
bioRxiv - Genetics 2021Quote: ... using the Renilla Glo Kit (Promega) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... the Glutamate Glo Assay Kit (Promega) was used ...
-
bioRxiv - Microbiology 2021Quote: ... the Glucose Uptake-Glo kit (Promega) was used ...
-
bioRxiv - Microbiology 2022Quote: ... The T7 RiboMax express kit (Promega) was used for the in vitro production of 16S rRNA under standard conditions.
-
bioRxiv - Molecular Biology 2019Quote: ... using QuantiFluor ONE dsDNA kit (Promega) and library size was checked on the Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... using a luciferase assay kit (Promega). Results were normalized to β-galactosidase or Renilla activity (Galactostar ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the dual luciferase kit (Promega). Experiments were done at least in triplicate ...
-
bioRxiv - Biochemistry 2020Quote: The “ADP-Glo” kit (Promega, Wisconsin) was used to measure hydrolysis of ATP to ADP and inorganic phosphate by ATPase ...
-
bioRxiv - Bioengineering 2020Quote: ... Steady-Go luciferase assay kit (Promega) was used to measure the expression of luciferase in cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... a kit (Promega, Fitchburg, WI, USA) was used to perform TUNEL staining in accordance with manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... using GoTaq qPCR kit (Promega A6001). Plates were sealed using a microseal ‘B’ Adhesive Seal (Bio-Rad MSB1001 ...
-
bioRxiv - Biochemistry 2020Quote: ... Using PureYield Plasmid Midiprep kit (Promega), DNA preparations of selected clones were subjected to sequencing at Eurofins Genomics Canada.
-
bioRxiv - Cell Biology 2021Quote: ... with a HiBiT assay kit (Promega).
-
bioRxiv - Microbiology 2021Quote: ... The Luciferase Assay System kit (Promega) was used to measure the luciferase activity in sporozoite samples following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and NADP+/NADPH-Glo kits (Promega), respectively ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... or Wizard PCR purification kit (Promega), and then directly sequenced using the same and internal primers on an ABI 3130xl sequencer.
-
bioRxiv - Molecular Biology 2022Quote: ... GoScript Reverse Transcription Kit (Promega, #A5003) was used as per manufacturer instructions with the following modifications ...
-
bioRxiv - Microbiology 2023Quote: One step RT-PCR kit (Promega) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... using SIRT-Glo Assay kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... as per the kit’s instructions (Promega), 75,000 mouse Fcγ receptor IV (mFcγRIV)-expressing Jurkat effector cells were added to each well to engage with the Fc region of M2e serum antibodies bound to native M2e expressed on the surface of the infected cells ...