Labshake search
Citations for Promega :
651 - 700 of 1309 citations for 5 Cyanopyridin 3 yl methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Immunology 2023Quote: Proteasome activity was measured in cell lysates using the Proteasome-Glo™ 3 Substrate System (Promega, G8531). Corresponding reagents for testing as chymotrypsin-like ...
-
bioRxiv - Genomics 2023Quote: ... the final selection was performed by 3% agarose electrophoresis (80 V, 2 h, 1 kB Promega ladder). The selected clones were preincubated in growth medium (15 ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were adjusted to 3 mM EDTA and digested with 1.0 μg Trypsin/LysC mix (Promega #V5073) for 1 h at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were first transfected with 3′UTR luciferase constructs (10 ng) using FuGENE HD transfection reagent (Promega) for 4 hours then transfected with Dharmacon miR-199a-5p mimic (50 nM ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein was digested for overnight with 5 ng/µL trypsin (Promega Corporation) in 50 mM ammonium bicarbonate at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM MgCl2 (pH 7) and 40 U RNasin® Ribonuclease Inhibitor (Promega) at 30° C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM MgCl2 (pH 7) and 40 U RNasin® Ribonuclease Inhibitor (Promega) at 37° C 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 hr after stimulation using Nano-Glo® Luciferase Assay System (Promega). For each time point 200,000 cells were tested in triplicate for each cell line.
-
bioRxiv - Bioengineering 2021Quote: ... or PG48 at 5% molar ratio were incubated with trypsin gold protease (Promega) at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Each 5 μL fraction sample was treated with DNase I (cat #M6101, Promega) for 1 h at 37°C and then diluted 1:20 in 50 μg/mL yeast tRNA (cat #Am7119 ...
-
bioRxiv - Microbiology 2021Quote: ... the HIV 5′-UTR (nucleotides 1–497) was cloned into pSP72 vector (Promega) using BglII and EcoRI sites under the control of T7 promoter ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were then digested with 5 μg of trypsin (Promega, Sequence Grade). After an ON incubation at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µg of total RNA were treated with RQ1 RNase-free DNAse (Promega) for 2h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... and T7 RNA polymerase as well as 5 μL RNasin RNase inhibitor (Promega). Transcription reactions were left overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each reaction contained 5 μL of 2x SYBR Green mastermix (Promega, Benelux BV), 2.5 μL primer mix (forward and reverse ...
-
bioRxiv - Biochemistry 2022Quote: ... and impregnated with 75 µL of 5 ng/µL trypsin (trypsin gold; Promega) solution overnight at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Livers were incubated using Luciferase Cell Culture Lysis 5 x Reagent (Promega, E1531) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A total of 5 μL per well of 20x-NanoBRET Tracer K10 (Promega) at 10 μM for CSNK2A1 or 5 μM for CSNK2A2 in Tracer Dilution Buffer (Promega N291B ...
-
bioRxiv - Microbiology 2023Quote: ... were digested with a modified MS grade trypsin (Promega; 1:5 enzyme/protein) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were directly spiked with 5 pg of unmethylated lambda phage DNA (Promega) and subjected to bisulfite treatment and library construction using the post-bisulfite adaptor tagging (PBAT ...
-
bioRxiv - Cell Biology 2024Quote: ... A total of 5 µL per well of 20x-NanoBRET Tracer K10 (Promega) at 5 µM in Tracer Dilution Buffer (Promega N291B ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg purified RIPR protein fragment was incubated with TEV protease (Sigma/Promega) at a 1:10 v/v ratio overnight at 4 °C on a rolling mixer ...
-
bioRxiv - Cell Biology 2024Quote: ... RNAs were incubated with [5’-32P] pCp and T4 RNA ligase (Promega, M1051) O/N at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Genomics 2019Quote: ... Alternatively, ¼ of an agarose plug was soaked in GET solution (3% 2-mercaptoethanol, 0.5x QuantiFluor® dye (Promega), 1X TBE ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Genomics 2019Quote: ... the gel slices were then hydrated with 5 ng/uL sequencing grade trypsin (Promega) in 50 mM ammonium bicarbonate and digested overnight at 37°C on an orbital shaker ...
-
bioRxiv - Genomics 2019Quote: ... 1989.) 5-mC free Lambda genomic DNA was purchased from Promega (Madison, WI, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were co-injected with 5 pg of pRL-TK:renilla luciferase plasmid (Promega E2241) + 50 pg of the pGL4.23 luc2/miniP enhancer:luciferase plasmid and the following amounts of MOs or mRNAs into each dorsal marginal zone (dmz ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were subjected to a pulse with 5 µM biotin-HaloTag ligand (G828A, Promega) diluted in complete medium for 3 hours ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL GoTaq® Probe qPCR Master Mix with dUTP (2X) (Promega, Madison, WI), 0.2 μL GoScript™ RT Mix for 1-Step RT-qPCR (Promega ...