Labshake search
Citations for Promega :
6901 - 6950 of 8541 citations for Nitrite Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... the Qubit 2.0 using the Promega Quantifluor ONE kit (Promega, WI, USA) and the AATI Fragment Analyzer (Agilent Technologies Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Equal volume of Cell-Titer Glo Reagent (Cell-Titer Glo kit, Promega) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplified genes were purified via the Wizard PCR clean- up kit (Promega). The pRL814 (containing green fluorescent protein (GFP ...
-
bioRxiv - Biochemistry 2024Quote: ... Genomic DNA was isolated with the Wizard Genomic DNA Purification Kit (Promega). KOD Hot Start DNA polymerase (MilliporeSigma ...
-
bioRxiv - Genetics 2024Quote: ... Tissue sections (10 µm) were stained using a TUNEL kit (Promega, #G3250) according to the manufacturer’s protocol and the samples were imaged with an Olympus FV-1200 confocal microscope and processed in ImageJ.
-
bioRxiv - Immunology 2024Quote: ... Then reverse transcribed to cDNA using a GoSript Reverse Transcription kit (Promega). Real-time PCR was performed using SYBR Green Realtime PCR Master Mix (TOYOBO ...
-
bioRxiv - Physiology 2024Quote: ... Insulin and glucagon concentrations were measured by Lumit Immunoassay kit (Promega # W8022).
-
bioRxiv - Microbiology 2020Quote: ... Both NAD+ and NADH were quantified using NAD/NADH™-GLO kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... Genomic DNA was extracted from leaves using Wizard® Genomic Purification kit (Promega). Plant Tissue Protocol (Manufacturer protocol 3.E. ...
-
bioRxiv - Cancer Biology 2021Quote: ... and real-time PCR using GoTaq 2-Step RT-qPCR kit (Promega, A6110). All measurements were normalized against Actin as the internal control using the 2-ΔΔCt method (Figure 1—source data 3 and Figure 3—source data 2) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and DNaseI treated by Maxwell 16 LEV simplyRNA Cells Kit (Promega, Cat# AS1270) and Maxwell nucleic-acid extraction instrument (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Total GSH was measured from the supernatant using the GSH-Glo kit (Promega) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene-body labeling was performed using the Prime-A-Gene kit (Promega).
-
bioRxiv - Cell Biology 2020Quote: Endogenous ROS levels were measured using a ROS-GLO kit (Promega, Wisconsin, USA) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... OLIG2 immunostaining were applied after DeadEnd™ Fluorometric TUNEL System kit (Promega, G2350) to reveal TUNEL positive cells in OL lineage.
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR products were cleaned up using PCR clean up kit (# A9282, Promega). sgRNAs were synthesized using the MEGAShortScript™ Kit (# AM1354 ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA extraction was performed using Maxwell RSC simply RNA cell kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and purified twice with a miniprep kit (PureYield™ Plasmid Miniprep System, Promega). Plasmids were eluted with RNase free water and used as templates for in vitro gene expression (E ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega). Quantitative PCR was performed by using the Agilent Mx3000P qPCR system with the 2×SYBR Green qPCR Master Mix (Bimake) ...
-
bioRxiv - Immunology 2021Quote: ... Cartridges were further washed with Rapid digestion buffer (Promega, Rapid digestion buffer kit) and bound proteins were subjected to on-column digestion using mass spec grade Trypsin/Lys-C Rapid digestion enzyme (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... the mycelium DNA was extracted with the Maxwell RSC Plant DNA Kit (Promega) on the Maxwell RSC Instrument (Promega ...
-
bioRxiv - Plant Biology 2019Quote: ... Total RNA was extracted using the Maxwell 16 Lev Plant RNA Kit (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... cheiranthoides plant using Wizard® Genomic DNA Purification Kit (Promega, Madison WI, USA). The quantity and quality of genomic DNA was assessed using a Qubit 3 fluorometer (Thermo Fisher ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was removed by using the RQ1 DNase kit (Promega, Madison, Wisconsin, USA). DNA and RNA were quantified fluorimetrically using Quant-iT PicoGreen and Quant-iT RiboGreen (both Invitrogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Maxwell® RSC Blood DNA Kit (cat# AS1400, Promega, Madison, WI, USA) respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA samples were then purified using the Wizard SV PCR purification kit (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Genetics 2020Quote: DNA was isolated from spleen using the Wizard Genomic DNA Purification Kit (Promega) according to the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2020Quote: The RNA was transcribed to cDNA using M-MLV reverse transcription kit (Promega) following the manufacturer’s recommendations using a defined amount of RNA (1μg for bees and 50 ng for mites ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Genomic DNA was extracted with the DNA extraction IQ™ System kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from organoids using the Simply RNA Tissue kit (Promega, AS1340) on the Maxwell RSC 48 instrument (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... 35 and 42 were extracted with Wizard® Genomic DNA purification kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Bioengineering 2021Quote: ... was measured using the RealTime-Glo MT Cell Viability kit (Promega, Catalog #G9711). Both measures were repeated for three separate wells ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fragments excised from the gel purified by the DNA Purification kit (Promega) according to the maker instructions.
-
bioRxiv - Plant Biology 2021Quote: ... APOLO was transcribed using the T7 transcription kit (Promega; (Ariel et al., 2020)) ...
-
bioRxiv - Cell Biology 2021Quote: ... TUNEL staining on tissue sections was performed using the DeadEnd™ kit (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2019Quote: ... briefly genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega) and digested with the XbaI restriction enzyme (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Wizard DNA Purification kit (Promega, Madison, Wisconsin) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted using the SV Total RNA Isolation kit (Promega, Wisconsin, USA). RNA was DNase treated using the Turbo DNase kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Bioluminescence generated by Gaussia luciferase was measured using the Renilla luciferase kit (Promega) on a FLUOstar Omega plate reader (BMG Labtech) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard® Genomic DNA Purification Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Santiago-089 was extracted using the Wizard genomic DNA purification kit (Promega, USA) and sequenced at MicrobesNG (University of Birmingham ...
-
bioRxiv - Molecular Biology 2021Quote: ... Yeast genomic DNA was isolated using a Wizard Genomic DNA Purification Kit (Promega) and digested with XhoI ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted using a Maxwell 16 Cell DNA Purification Kit (Promega). Genomic DNA libraries were prepared using a Nextera XT kit (Illumina ...
-
bioRxiv - Pathology 2021Quote: ... Total RNA extraction was performed using the SV RNA Isolation System Kit (Promega), following the manufacturers’ recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Cytotoxicity was quantified colorimetrically with the CytoTox96 lactate dehydrogenase (LDH)-release kit (Promega). The percentage of cytotoxicity was calculated with the formula ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega). qPCR reactions of 10 µL were set up with 5 µL PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2020Quote: ... and chromosomal DNA was prepared using the Wizard Genomic DNA Purification Kit (Promega).