Labshake search
Citations for Promega :
6601 - 6650 of 8213 citations for QuantiChrom Indole Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The fragments excised from the gel purified by the DNA Purification kit (Promega) according to the maker instructions.
-
bioRxiv - Plant Biology 2021Quote: ... APOLO was transcribed using the T7 transcription kit (Promega; (Ariel et al., 2020)) ...
-
bioRxiv - Cell Biology 2021Quote: ... TUNEL staining on tissue sections was performed using the DeadEnd™ kit (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2019Quote: ... briefly genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega) and digested with the XbaI restriction enzyme (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Wizard DNA Purification kit (Promega, Madison, Wisconsin) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted using the SV Total RNA Isolation kit (Promega, Wisconsin, USA). RNA was DNase treated using the Turbo DNase kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Bioluminescence generated by Gaussia luciferase was measured using the Renilla luciferase kit (Promega) on a FLUOstar Omega plate reader (BMG Labtech) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard® Genomic DNA Purification Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Santiago-089 was extracted using the Wizard genomic DNA purification kit (Promega, USA) and sequenced at MicrobesNG (University of Birmingham ...
-
bioRxiv - Molecular Biology 2021Quote: ... Yeast genomic DNA was isolated using a Wizard Genomic DNA Purification Kit (Promega) and digested with XhoI ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted using a Maxwell 16 Cell DNA Purification Kit (Promega). Genomic DNA libraries were prepared using a Nextera XT kit (Illumina ...
-
bioRxiv - Pathology 2021Quote: ... Total RNA extraction was performed using the SV RNA Isolation System Kit (Promega), following the manufacturers’ recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Cytotoxicity was quantified colorimetrically with the CytoTox96 lactate dehydrogenase (LDH)-release kit (Promega). The percentage of cytotoxicity was calculated with the formula ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega). qPCR reactions of 10 µL were set up with 5 µL PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2020Quote: ... and chromosomal DNA was prepared using the Wizard Genomic DNA Purification Kit (Promega).
-
bioRxiv - Cancer Biology 2020Quote: Cell viability was determined by CellTiter 96 aqueous one solution proliferation kit (Promega) and/or CellCountingKit-8 (CCK-8 ...
-
bioRxiv - Cell Biology 2021Quote: ... All cell lines have been DNA fingerprinted using the PowerPlex 1.2 kit (Promega) and were found to be mycoplasma free using the e-Myco kit (Boca Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Levels of accumulated cAMP were detected with the cAMP-Glo™ kit (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... activity of both reporters was measured using the Dual-Luciferase Reporter kit (Promega) and read on a Tecan Infinite 200 PRO Reader ...
-
bioRxiv - Immunology 2022Quote: RNA was first reverse-transcribed to cDNA using GoScript Reverse Transcriptase kit (Promega) following the manufacturers protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and the first second PCR kits were obtained from Promega (M7122, Madison, USA).
-
bioRxiv - Molecular Biology 2022Quote: ... and firefly luciferase activity was assayed using the Dual Reporter Luciferase kit (Promega).
-
bioRxiv - Pathology 2022Quote: ... LDH activity in the supernatants was measured using CytoTox 96 kit (Promega, G1780) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted following the Maxwell 16 LEV Tissue RNA Kit protocol (Promega). For tissue-specific assays ...
-
bioRxiv - Biochemistry 2022Quote: ... using the Wizard® Genomic DNA Purification kit (Promega, Charbonnières-Les-Bains, France). The final pellet was resuspended in 40 μL of sterile ultra-high quality (UHQ ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was robotically extracted using the Maxwell tissue RNA extraction kit (Promega) and quantified using the Nanodrop ND-1000 UV-Vis Spectrophotometer (Nanodrop technologies ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was extracted using the Wizard Genomic DNA Purification kit (Promega, A1120) following the manufacturers’ guidelines and quantified using the Nanodrop 2000 Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: Measurement of CYP3A4 enzymatic activity was performed using the P450 Glo kit (Promega). Cells were incubate with 1:1000 luciferin-IPA in Hepatozyme complete for 1h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was isolated using the Wizard® Genomic DNA Purification kit (Promega). Cells were resuspended in 100 μl of 50mM EDTA with 500U PlyC and incubated at 37 °C with shaking for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA isolation was performed using a Wizard Genomic DNA purification kit (Promega). Plasmid isolation was performed with GenElute plasmid miniprep kit (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: Intracellular adenosine triphosphate (ATP) levels were measured using a BacTiter-Glo kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was extracted using the Wizard Genomic DNA Purification kit (Promega, Madison, WI) and the Quick Gene DNA whole blood kit S (Fugifilm ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was extracted carefully by Wizard® Genomic DNA Purification Kit (Promega, A1125), washed with 70% EtOH ...
-
bioRxiv - Developmental Biology 2022Quote: ... After removing the residual genomic DNA with the DNase I Kit (Promega, M6101), 500 ng of total RNA was reverse-transcribed into cDNAs using the PrimeScript RT Reagent Kit (TaKaRa ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA synthesis was carried out using the GoScript™ Reverse Transcription kit (Promega). cDNA was diluted 1:30 into molecular biology grade water and used as template in qRT-PCR reactions using SYBR Green (Applied Biosystems™ ...
-
bioRxiv - Cell Biology 2019Quote: Total cell RNA was extracted using the SV Total RNA Isolation Kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was synthetized from 1µg RNA using the Reverse Transcription system kit (Promega). The qPCR reactions were performed with PowerUp™ SYBR™ Green Master Mix (Thermofisher ...
-
bioRxiv - Cell Biology 2019Quote: ... All cells were authenticated by STR profiling (GenePrint 10 System kit from Promega and AuthentiFiler PCR Amplification Kit from ThermoFisher ...
-
bioRxiv - Bioengineering 2019Quote: ... cell viability was determined using a Cell Titer Aqueous One Solution kit (Promega).
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA was yielded from purified mRNA using ImProm II Reverse Transcription kit (Promega). Quantitative-RT PCR was then performed using the SensiFAST SYBR Green Hi-ROX master mix (Bioline) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Both PCR products were purified using the Wizard PCR cleanup kit (Promega, USA).
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA isolation was performed using the Wizard Genomic DNA Purification kit (Promega).
-
bioRxiv - Zoology 2021Quote: ... PCR products were purified with Wizard SV Gel and PCR Cleanup kit (Promega). Purified products were sequenced at Sequetech DNA Sequence Service (Mountain View ...
-
bioRxiv - Physiology 2021Quote: ... DNA was extracted using the Wizard Genomic DNA Extraction Kit (Promega, Wisconsin, USA) and shipped on ice to the Wellcome Sanger Institute for sequencing using the Illumina platform as described previously 15 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Presence of HBsAg in organoid supernatant was assessed using the MonaLisa Kit (Promega) according to manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: ... Genomic DNA was extracted using the Wizard SV genomic DNA purification kit (Promega). Multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was carried out using the GoScript™ Reverse Transcription kit (Promega). cDNA was diluted 1:30 into molecular biology grade water and amplification was quantified using SYBR Green (Applied Biosystems™) ...
-
bioRxiv - Microbiology 2019Quote: Total RNA was extracted from PM1 cells using the ReliaPrep RNA Kit (Promega). One-step reverse transcription qPCR (Quantbio ...