Labshake search
Citations for Promega :
601 - 650 of 5848 citations for Human V Set And Immunoglobulin Domain Containing Protein 2 VSIG2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko 37 ...
-
bioRxiv - Microbiology 2021Quote: ... Digested protein suspensions with 4 μg trypsin (Promega) in 40 μL 25 mM NH4HCO3 buffer at 37 °C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of the Halo-tag protein (Promega), with the insertion of a 45-base linker (15 amino acids ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko49 ...
-
bioRxiv - Microbiology 2020Quote: ... to enable visualization of protein bands (Promega, USA). Each experiment was performed at least three times.
-
bioRxiv - Microbiology 2020Quote: Proteins were digested with sequencing-grade trypsin (Promega) and analyzed by nanoLC-MS/MS on a TripleTOF 5600 mass spectrometer (Sciex ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were digested with trypsin (Promega, Madison, WI) at an enzyme-to-substrate ratio of ~1:50 for 12 hours in a thermomixer ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were proteolytically digested with trypsin (Promega) and purified using OMIX C18 Mini-Bed tips (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... Two hundred μL of protein precipitate solution (Promega) was added ...
-
bioRxiv - Plant Biology 2022Quote: ... total proteins were extracted in lysis buffer (Promega), then Firefly and control Renilla LUC activities were quantified with FLUOstar Omega luminometer (BMG Labtech ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were digested using trypsin (Trypsin Gold, Promega) in a 1:50 protein to enzyme ratio and incubation for 18h at 37°C on a thermo-shaker at 600 rpm ...
-
bioRxiv - Developmental Biology 2021Quote: ... proteins were trypsinized (Sequencing Grade Modified Trypsin, Promega) and digested peptides were collected by centrifugation ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were further digested with trypsin (Promega) in 10 ng/µL (enzyme-to-protein ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were then digested with modified trypsin (Promega) at an enzyme/substrate ratio of 1:50 in 100 mM ammonium bicarbonate ...
-
bioRxiv - Microbiology 2019Quote: ... the proteins were proteolytically digested with trypsin (Promega) and purified using OMIX C18 Mini-Bed tips (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were then digested with modified trypsin (Promega) at an enzyme/substrate ratio of 1:50 in 100mM ammonium acetate ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins were digested with trypsin (Promega, Fitchburg, WI) for 14 hours at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko [46] ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein A/G magnetic beads (100 µL) (Promega) were washed with HB prior to addition to the RiboTag-IP fraction and were rotated at 4°C overnight ...
-
bioRxiv - Immunology 2020Quote: ... protein samples were treated with PNGase F (Promega) according to manufacturer’s instruction under denaturing conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested with trypsin (Promega, Madison, USA) at an enzyme-to-protein ratio of 1:100 (w/w ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were digested with sequencing-grade trypsin (Promega) at room temperature while shaking overnight ...
-
bioRxiv - Neuroscience 2019Quote: ... proteins were digested with 0.3 µg LysC (Promega) for 16 h at 37°C followed by a second digestion step with 0.15 µg trypsin (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... proteins were digested with 1 µg trypsin (Promega) and subjected to liquid chromatography (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ingel protein digestion using trypsin (Promega, Mannheim, Germany) was performed essentially as described before62 ...
-
bioRxiv - Biochemistry 2022Quote: ... the proteins were deglycosylated by Endo-H (Promega) followed by PNGaseF (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were digested with trypsin (sequencing grade, Promega) at 37°C overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko (Shevchenko et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Proteins were then digested with modified trypsin (Promega) at an enzyme/substrate ratio of 1:50 in 100 mM ammonium bicarbonate ...
-
bioRxiv - Microbiology 2023Quote: ... precipitated proteins were first treated with trypsin (Promega) in 50 mM ammonium bicarbonate solution ...
-
bioRxiv - Molecular Biology 2023Quote: Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko78 ...
-
bioRxiv - Cell Biology 2023Quote: ... Add 200 μl of Protein Precipitation Solution (Promega) and mix by pipetting ...
-
bioRxiv - Physiology 2023Quote: ... Proteins were digested using sequencing grade trypsin (Promega) at a 1:40 (w/w ...
-
bioRxiv - Neuroscience 2023Quote: ... Purified HaloTag protein (#G4491) was purchased from Promega. Pluronic F-127 (# P3000MP) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Proteins were digested with Lys-C/Trypsin (Promega) at 37 °C overnight with rotation ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were digested with trypsin (Promega, Wisconsin, USA) in a ratio of 1:100 at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were on-bead digested with trypsin (Promega) at 37 °C for 16 h with orbital shaking ...
-
bioRxiv - Neuroscience 2024Quote: ... The proteins were digested overnight with trypsin (Promega) at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein precipitations were digested with Trypsin (Promega, #V5113) diluted in Digestion buffer (100 mM Ammonium Bicarbonate and 10% Acetonitrile ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected with transfection mix containing 50 μL FuGENE HD (Promega) and 1000 μL Opti-MEM (Thermofisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 μL 40mM ABC containing 0.5 μL of trypsin gold (Promega, V528A) in PBS was added to each sample and samples were incubated overnight at 37°C in a closed ...
-
bioRxiv - Bioengineering 2019Quote: ... permeabilized with tris-buffered saline (TBS) containing 0.5% Triton X-100 (Promega), and blocked with AbDil (2 wt % bovine serum albumin (BSA ...
-
bioRxiv - Pathology 2020Quote: ... respectively) containing β-galactosidase (1 mg/ml; Cat # V394A; Promega, Madison, WI). Samples were post fixed in formalin overnight and then stored in ethanol (70%).
-
bioRxiv - Microbiology 2019Quote: ... containing 500 μl of nuclease free water (Cat. N°. P119C/Promega/U.S.A). The upper part of the swabs was cut using sterile scissors to allow closing of the tube ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 100 nM bafilomycin A1 and 37.5 nM TMRDirect Halo Ligand (Promega). After 2 hours in EBSS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pGL3-basic plasmid containing a reporter gene was purchased from Promega Co ...
-
bioRxiv - Physiology 2021Quote: ... pH 8) containing a cocktail of protease inhibitors (Promega Corporation, Madison, WI) using a Precellys24 and 2 mm zirconium oxide beads (2 x 25 s at 6800 rpm ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5% Sodium deoxycholate and 0.1% SDS) containing protease inhibitors (Promega, Madison, USA) and centrifuged at 10,000× g (30 min at 4°C) ...
-
bioRxiv - Microbiology 2020Quote: ... containing 13.5 μL of GoTaq Green Master Mix (Promega, Cat No.: M7123), 1.5 μL of Human GAPDH Forward Primer (5’– AGAAGGCTGGGGCTCATTTG–3’) ...
-
bioRxiv - Molecular Biology 2020Quote: ... this was assessed using a luciferase positive control pGL3 containing SV40 (Promega) and trypan blue staining ...