Labshake search
Citations for Promega :
601 - 650 of 4196 citations for 4 3 2 Chloroethyl 3 nitrosoureido tetrahydro 2H thiopyran 1 1 dioxide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Samples were again diluted to 2 M urea and digested with 1 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Systems Biology 2023Quote: The transfections were performed with a 1 mg DNA: 2 ml Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Biochemistry 2024Quote: ... pH 8.0) containing 2 nM 11S and 1/250 Nano-Glo Luciferase Assay Reagent (Promega) was added to the cells and background luminescence read for 5 min ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Cancer Biology 2023Quote: ... ZR-75-1 cells were short tandem repeat tested every 4 months (Stem Elite ID System, Promega). Doxorubicin (S1208) ...
-
bioRxiv - Genetics 2022Quote: ... Samples were diluted 1:4 with 50mM Tris/HCl (pH 8.0) and sequencing grade modified trypsin (Promega) was added in an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Systems Biology 2024Quote: ... samples were diluted 1:4 with 50 mM Tris–HCl pH 8 and sequencing grade trypsin (Promega) was added at 1:50 ratio ...
-
bioRxiv - Synthetic Biology 2024Quote: ... after which they were treated with 1 µL RNase A (4 mg/mL RNAse A solution, Promega), and 1 µL RNase One (10 units/µL RNase ONE Ribonuclease solution ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with PBS and lysed with 100 µL of 0.05% Triton X-100 (Promega). The contents of the well were serially diluted ...
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with PBS and lysed with 100 µL of 0.05% Triton X-100 (Promega). The contents of the well were serially diluted ...
-
bioRxiv - Microbiology 2024Quote: ... Concentrated protein extracts were then digested with 3 µl trypsin according to manufacturer’s instruction (Promega, Madison, WI, USA) at 37 °C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... the wild type and mutated Nnat 3’UTR was inserted into a pmirGLO dual-luciferase expression vector (Promega). Detailed description of the design of these constructs and of the rescue constructs are listed in the supplementary material section ...
-
bioRxiv - Plant Biology 2024Quote: ... At least 3 independent technical experiments were performed from each RNA sample using SYBR Green Master Mix (Promega) with Chromo4 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptotic cell count was measured as described above using the Caspase-Glo® 3/7 3D Assay (Promega). Bliss synergy scores were calculated using the SynergyFinder web application (version 3.0)61.
-
bioRxiv - Cancer Biology 2024Quote: ... Further confirmation of apoptosis was performed using the Caspase-Glo 3/7 Assay (Promega UK, Cat No:8091) system ...
-
bioRxiv - Neuroscience 2020Quote: ... all cells were incubated in the following: mouse anti-βIII tubulin (1:1000; 2 hr; Promega) and goat anti-mouse Alexa 546 (1:1000 ...
-
bioRxiv - Systems Biology 2021Quote: ... Both 1° and 2° assays were performed with 2x PCR master mix (Promega Corporation, Wisconsin, USA). The final PCR product from the 2° nested PCR was checked by electrophoresis in a 1.5% agarose gel ...
-
bioRxiv - Immunology 2021Quote: ... Purified mAb (2 mg/mL in PBS) was treated with 1 unit of IdeS protease (Promega) per 1 µg of mAb ...
-
bioRxiv - Plant Biology 2022Quote: ... for 2 h as primary antibody and peroxidase-conjugated goat anti-rabbit antibody (1:10,000; Promega) for 1 h with 5 times 10 min washes in-between the incubations ...
-
bioRxiv - Immunology 2024Quote: ... 1 mL of warm (37-40°C) 2% agarose low-melting point (Promega® Cat. V2111) was infused through the trachea into the lungs using a polythene tube with a 1.5 mm diameter (Portex Cat ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by the secondary antibody for 1 h at +4 °C (anti-rabbit IgG-HRP, Promega 65-6120). The Pierce® enhanced chemiluminescence substrate (Thermo-Fischer Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:4 with 50 mM Tris/HCl (pH 8.0) and sequencing grade modified trypsin (Promega) was added in an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... pre-ran reaction solutions were incubated with 1 µL RNase A (4 mg/mL RNAse A solution, Promega), and 1 µL RNase One (10 units/µL RNase ONE Ribonuclease solution ...
-
bioRxiv - Genomics 2021Quote: ... 1 U μl−1 RNasein (Promega), 0.1% IGEPAL CA-630 (Sigma)) ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Genomics 2020Quote: ... 3 ug of pCAG-NLS-Bxb1 was diluted in 250 uL of OptiMEM and 6 uL of Fugene (Promega). On day 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Immunology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately O/N using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Pathology 2021Quote: ... Cytopathic effects of the virus were measured after 3 days using the CellTiter-Glo luminescent cell viability assay (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Cell Biology 2020Quote: ... The sample was first treated by 2.5 μg of LysC (Wako) for 3 h at 37 °C with shaking and then treated with 2.5 μg of Trypsin (Promega) for over-night at 37 °C with shaking ...