Labshake search
Citations for Promega :
601 - 650 of 748 citations for 3 3 Bromomethyl phenyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... The PC-3 cell line was authenticated by Macrogen (Korea) using short tandem repeat (STR) profiling (Powerplex 21 System, Promega). All cell lines tested negative for mycoplasma contamination using the Microsart AMP Mycoplasma Kit (Sartorius).
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... All transfections were done in triplicate and luciferase activity measured after 3 days using the Dual Luciferase Reporter Assay System (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... total RNA was purified from 3-4 tissues of female flies using a ReliaPrep RNA Tissue Miniprep kit (Promega, z6112). Quantitative RT-PCR was performed using a OneTaq RT‒PCR kit (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Biochemistry 2023Quote: ... using 3 µl of the in vitro translation reaction mixture in 150 µl of luciferase assay reagent (Promega, Fitchburg, WI). The graphs in Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PCR amplified from the genome (Tom-3’UTR, primers are in Table S1) and cloned into the psiCHECK-2 vector (Promega) linearized with XhoI and NotI restriction enzymes ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Immunology 2023Quote: ... Select colonies were then grown in 3 ml of LB with appropriate antibiotics and the plasmids were purified with PureYield Plasmid Miniprep System (Promega), performing restriction enzyme digests to verify that the plasmids had inserts.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The transfected neurons were stimulated with 200μM glycine for 3 min and then washed for 30 minutes before lysis in 100 μl of buffer for dual luciferase assay (Promega). 20 μl of the lysates were used for the quantification of Firefly and Renilla Luciferase activity using a Luminometer (GloMax ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were cultured for 3 days and cell viability was measured using CellTiter-Glo® 3D Cell viability assay (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed for the splicing analysis with the 3 µl of cDNA in a total volume of 20 µl with GoTaq Polymerase 2X (Promega) and 32 amplification cycles ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Cell Biology 2023Quote: Protein-protein interactions between Mkl1/2 and Foxo1/3/4 or glucocorticoid receptors were also measured using NanoBiT PPI Starter Systems (Promega). 293FT cells were seeded in 96-well white wall microplates and co-transfected with the LgBiT and SmBiT plasmids ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and mutant Shank2 and Mdga1 3′ UTR luciferase constructs were generated by standard cloning procedures into pmiRGLO dual-luciferase expression vector (Promega). First ...
-
bioRxiv - Cell Biology 2023Quote: The Human SART1 mutant resistant to siSART1#3 and its deletions mutants (amplified by PCR) were subcloned into pCI-neo Mammalian Expression Vector (Promega).
-
bioRxiv - Cancer Biology 2023Quote: Caspase3/7 activity was quantified in cell lysates using the Kit Caspase-Glo® 3/7 Assay Systems (G8091, Promega).
-
bioRxiv - Cell Biology 2023Quote: ... was added to 3 of the wells per treatment condition and 50 µL Oxidized Glutathione Lysis Reagent (Promega Cat #TM344) was added to the other 3 wells per treatment condition ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The amplified products were ligated into the Xho I and Sal I sites of the 3’UTR of the firefly luciferase gene in the pmirGLO Dual-Luciferase miRNA Target Expression vector (E 1330, Promega) to generate pmiR-Mecp2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... + 0.5 μg of “reporter” plasmid (pJBM560 and derivatives thereof) + 0.25 μg of pCEP/GFP using 3 μL FuGENE® HD (Promega); the following day ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were collected at indicated time points and mixed with equal parts Promega Caspase-Glo 3/7 reagent (Promega G8090) and incubated for 45 min ...
-
bioRxiv - Molecular Biology 2024Quote: Luciferase PRE reporters were generated by inserting PRE repeats into the 3’UTR of Renilla luciferase in the psiCheck-2 dual luciferase reporter vector (Promega) (Table S7) ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...
-
bioRxiv - Plant Biology 2024Quote: ... using either entire/partial coding sequences or 3′-untranslated region of each gene were cloned into pGEM T-easy vectors (Promega). The plasmids were linearized by restriction endonucleases ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Molecular Biology 2024Quote: ... + 0.5 μg of “reporter” plasmid (pAluneoTet or other SINE reporter plasmids) + 0.25 μg of pCEP/GFP using 3 μL FuGENE® HD (Promega); the following day ...
-
bioRxiv - Molecular Biology 2024Quote: ... the HeLa-HA cells were transfected with 0.5 μg of “driver” plasmid (TMO2F3) + 0.5 μg of “reporter” plasmid (AluneoTet or other Alu reporter plasmids) using 3 μL FuGENE® HD (Promega). The following day (∼24 hours) ...
-
bioRxiv - Molecular Biology 2024Quote: 5’Cy5-DNA probes were produced commercially and 3’-UTP-Cy5 ligation was performed at 37°C on double-strand DNA with terminal Deoxynucleotidyl Transferase (TdT) (Promega). The 5’-Cy5 labelled complementary oligonucleotides were annealed before the reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... each cell line was single-cell cloned and two of each clone (WT pool, WT Clone 3, HMCES−/− Clones 3.1, 3.3, 3.4) were harvested for genomic DNA (Promega Cat No. A1120). Genomic DNA was submitted for 150 bp paired-end Illumina dep-sequencing sequencing targeting 30X depth at Vanderbilt University’s VANTAGE Next Generation-Sequencing core.
-
Aberrant regulation of serine metabolism drives extracellular vesicle release and cancer progressionbioRxiv - Cancer Biology 2024Quote: ... The annealed oligos were ligated into the Xho I and Not I sites in the 3’UTR of the Renilla luciferase gene in the psiCHECK-2 plasmid (C8021, Promega). Each plasmid was transfected individually into HEK 293 cells with miR-891b using DharmaFECT 1 Transfection Reagent (T-2001-03 ...
-
The myokine FGF21 associates with enhanced survival in ALS and mitigates stress-induced cytotoxicitybioRxiv - Neuroscience 2024Quote: ... following the manufacturer’s instructions and as previously described.25 Apoptosis was detected by caspase activity using Caspase-Glo 3/7 assay kit (Promega) following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptotic and viability effects of CM-272 on treated primary AML cells was investigated by the Caspase-Glo 3/7 assay (G8981, Promega) following the manufacturer’s instructions and measured in the FLUOstar Omega microplate reader ...
-
bioRxiv - Bioengineering 2024Quote: ... control and printed aggregates were collected for 4 hours and 3 days post-printing and tested following the CellTiter96 (Promega) assay protocol ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transfection was done using a ratio 3:1 volume-to-mass ratio of FuGENE6 (0.3 µL reagent: 100 ng of DNA per well, Promega E2691). The transfection mix included the following vectors ...
-
bioRxiv - Cancer Biology 2024Quote: ... 95% humidity for 3 days (72 hours. Cell viability was assessed by the CellTiter-Glo luminescent cell viability assay (Promega). SynergyFinder (https://synergyfinder.fimm.fi ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 mM NaCl, 3 mM MgCl2, 1% BSA, 0.1% Tween-20, 1 mM DTT and 1 U/uL RnaseIn, Promega©) was added to the lysed cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatant was harvested after 3 days of co-culture and IFNγ secretion was analyzed using the Lumit human IFNγ Immunoassay (Promega) according to the manual and T-cells were analyzed for 4-1BB expression by flow cytometry.
-
bioRxiv - Cell Biology 2024Quote: ... protein samples were then incubated with chymotrypsin at a ratio of 1:80 (enzyme to protein) for 3-4 h at RT and then trypsin (Promega) at a ratio of 1:80 (enzyme to protein ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were seeded onto acid-washed coverslips to ensure surface cleanliness and cell adherence at a density of 3 × 104 cells per coverslip for 24 h before transfection with 1 μg of plasmid DNA using 3 μL Fugene HD transfection reagent (Promega). HaloTagged AP2-σ2 was visualized by adding the JF646-HaloTag ligand (Promega) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... on the 12th day (n=3 individuals/ dietary treatment/sex) and isolated microbial DNA using a Wizard genomic DNA isolation kit (Promega) following the manufacturer’s protocol ...