Labshake search
Citations for Promega :
551 - 600 of 2354 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Digestion reaction for proteins was initially set up with 1 μg of MS grade LysC (Promega, Cat# PI90307) for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR reaction was subjected to DpnI digestion and PCR cleanup (Promega Wizard SV Gel and PCR Clean-Up System). 30 ng of PCR amplified pUC19 ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR reactions were carried out using GoTaq green PCR reaction buffer (Promega). DNA was cycled according to the following protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR reactions were carried out using GoTaq green PCR reaction buffer (Promega). DNA was cycled according to the following protocol ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR products were purified using a Wizard PCR clean-up kit (Promega) before sequencing (Eurofins Genomics).
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real-time PCR was performed using GoTaq PCR Master Mix (Promega) or PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCRs using the GoTaq Long PCR Master Mix (Promega Corp, Wisconsin, USA) using 0.6-0.8 μM of each primer and a modified touchdown PCR protocol for the largest amplicon (Don et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... All RT-qPCRs were done using the GoTaq qPCR Master Mix (Promega, A6002) in a CFX384 real-time PCR detection system (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Physiology 2020Quote: ... with cDNA produced using the ImProm-II RT system (Promega, Madison, WI, USA). Real-time quantitative PCR was performed using a Prism 7000 (Applied Biosystems ...
-
bioRxiv - Pathology 2021Quote: ... pre-treated with DNAse (50u/ml, 15min RT, RQ1 RNAase free DNAse, Promega) and cytoplasmic fractions were adjusted ...
-
bioRxiv - Pathology 2021Quote: ... and reverse transcription (RT) was performed using MMLV reverse transcriptase (Promega, Charbonnieres, France), as recommended by the manufacturers ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Promega, Madison, WI), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... GoTaq® Probe 1-Step RT-qPCR System was purchased from Promega (US). SARS-CoV-2 (2019nCoV ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription was performed with M-MLV RT Enzyme (Promega, Madison, WI, USA) and oligo-dT (T12 and T16 mix ...
-
bioRxiv - Microbiology 2023Quote: ... the RNA was further reverse transcribed to cDNA using MMLV-RT (Promega, USA) and used for downstream mRNA qPCR assays ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was prepared by reverse transcription (GoTaq 2-Step RT-qPCR System, Promega) and amplified byPCR using SYBR® Green PCR Master Mix and ABI Prism7900HT sequence detection system (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was prepared by reverse transcription (GoTaq 2-Step RT-qPCR System, Promega) and amplified by PCR using SYBR® Green PCR Master Mix and ABI Prism 7900HT sequence detection system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR clean-up (Promega), and quantification ...
-
bioRxiv - Microbiology 2022Quote: ... and PCR (Promega #M7806) using primers flanking the sequence targeted by the sgRNA (Table S2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The promoter was amplified with primers XI6247/XI6248 and cloned into pGEM-Teasy (Promega) to create pCB4594 ...
-
bioRxiv - Cell Biology 2019Quote: Reverse transcription was carried out with 2µg of total RNA and random primers (Promega), followed by treatment with RNase H (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... 9 μl purified RNA was incubated with 1 μl Oligo(dT)15 primers (Promega) at 80°C for 3 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and reverse transcribed with random primers using the GoScript Reverse Transcription kit (Promega, USA). Reverse transcription quantitative PCR (RT-qPCR ...
-
Kinetics Of Interferon-λ And Receptor Expression In Response To In Vitro Respiratory Viral InfectionbioRxiv - Immunology 2021Quote: ... and then directly reverse transcribed using oligo-dT16 primers and MMLV reverse transcriptase (Promega). Complementary DNA synthesis was carried out at 42°C for 60 min ...
-
bioRxiv - Biophysics 2021Quote: ... The primer sequence of SmBiT was designed from pBiT2.1-N [TK/SmBiT] Vector (Promega).
-
bioRxiv - Physiology 2022Quote: ... Total RNA (1.5 μg) was reverse transcribed using random primers and MMLV (Promega, USA). Each cDNA sample was analyzed in triplicate with the Applied Biosystems Prism7900HT Real-Time PCR System using Absolute SYBR Green (ABI ...
-
bioRxiv - Microbiology 2020Quote: ... and amplified using specific primers flanking each gene region with GoTaq DNA Polymerase (Promega). PCR products were run on an agarose gel ...
-
bioRxiv - Developmental Biology 2023Quote: ... using primers listed in Table S8 and cloned into pGL4.24[luc2P/minP] (Promega, E8421) with NEBuilder HiFi DNA Assembly kit (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... in a 20-μl final volume reaction using random primers (Cat. No. C1181; Promega) in the presence of 20 units of RNasin (Recombinant Ribonuclease Inhibitor ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Total RNA extract (1 µg) was incubated with random primers (Promega, Madison, WI, USA) at 70°C for 5 min and subsequently cooled on ice ...
-
bioRxiv - Plant Biology 2023Quote: ... with primer dimers being removed using the ProNex Size-Selective Purification System (Promega, NG2001). After a second PCR amplification— 98°C for 30 s (1X) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.0 μg of RNA was reverse transcribed using random hexamer primers (Promega, Tokyo, Japan) and ImProm II reverse transcriptase (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... Once all reactions had been set up the plate was moved to a GloMax® Explorer plate reader (Promega) and incubated for 40 min at 25 °C before reading for luminescence ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR reactions were set up as follows: 6.25 µl of GoTaq® qPCR Master Mix (Promega, Madison, WI, USA), 4.25 µl of nuclease-free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR products were cleaned up using PCR clean up kit (# A9282, Promega). sgRNAs were synthesized using the MEGAShortScript™ Kit (# AM1354 ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified using the Wizard PCR Preps DNA Purification System (Promega) and DNA sequencing was performed using primer 2569 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Both PCR products were purified using the Wizard PCR cleanup kit (Promega, USA).
-
bioRxiv - Zoology 2021Quote: ... PCR products were purified with Wizard SV Gel and PCR Cleanup kit (Promega). Purified products were sequenced at Sequetech DNA Sequence Service (Mountain View ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were carried out using a 2x GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Microbiology 2024Quote: ... Quantitative real-time PCR (qRT-PCR) was performed with the GoTaq polymerase (Promega) and a StepOnePlus real-time PCR device (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and qRT-PCR was performed using the GoTaq qRT-PCR master mix (Promega) with the ViiA7 Real Time PCR system (Applied Biosystems) ...
-
bioRxiv - Pathology 2023Quote: ... USA) using SYBR Green PCR or TaqMan Universal PCR master mixes (Go Taq Probe PCR Master Mix; Promega, A600A or A610A, respectively). The following TaqMan probes were used ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... First strand cDNA was synthesized using 5μg pure RNA and M-MLV RT (Promega). qPCR was performed using pure cDNA and qPCR kit (Agilent technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... USA) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15min for reverse transcription ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plates were incubated for 1 h at RT and luminescence recorded (Glowmax Luminometer, Promega) and then compared to Glucose/Lactate standards to determine relevant concentrations.
-
bioRxiv - Microbiology 2021Quote: ... incubated for 1 h at RT and analysed using the GloMax multidetection system (Promega). Parasitaemia was used to normalise parasite density between samples and replicates ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA libraries were generated using M-MLV RT [H-] Point mutant (Promega, WI, USA) according to the manufacturer’s directions ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 μL of 4X concentrated Realtime-Glo (RT-Glo) reagent (Promega, Madison, WI, USA) diluted in antibiotic-free medium was dispensed ...