Labshake search
Citations for Promega :
551 - 600 of 816 citations for Ectonucleotide pyrophosphatase phosphodiesterase family member 7 ENPP7 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were processed at different times post inoculation (pi) according to manufacturer’s instructions (Caspase-Glo® 3/7 Assay kit, Promega, USA) to determine caspase 3/7 activity ...
-
bioRxiv - Molecular Biology 2022Quote: Developing was performed using chemiluminescence reaction (ECL, GE-Healthcare) with secondary coupled to HRP (Promega, 1/5000e) and the Amersham ImageQuant 800 (Cytiva).
-
bioRxiv - Biochemistry 2023Quote: ... and assayed with 4 μM of HRP and 20 μL of Nano Glo luciferase substrate (Promega, N1110) diluted to 1:1000.
-
bioRxiv - Cell Biology 2021Quote: ... LgBiT antibody (N710A) and HiBiT antibody were acquired from Promega. Chicken polyclonal MAP2 (ab5392) ...
-
bioRxiv - Immunology 2023Quote: ... Secondary antibodies (Promega) were incubated for 1 h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... SEA (0.2 mg/ml) and soluble schistosomula antigens (0.2 mg/ml) was determined using the Caspase-Glo® 3/7 Assay System (Promega, Sydney, Australia) according to the manufacturers’ instructions.
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Cancer Biology 2024Quote: ... The drug and media were refreshed on day 3 and cell viability was assessed in the cell lines as compared with the vehicle condition (0.1% DMSO) at 7 days post treatment using MTS reagent (Promega, Madison, WI, USA). IC50 values were determined in the cell lines by dose-response curves calculated using the drc (v3.0.1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Plant Biology 2024Quote: ... The samples were diluted by the addition of 7 volumes of 25mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Neuroscience 2024Quote: ... Retinal cryosections (7 µm) from P14 and P16 mice were evaluated using the DeadEnd Fluorometric TUNEL System (# G3250, Promega, Madison, WI, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... After washing with TBST and incubation for 1 hour with anti-Rabbit IgG HRP Conjugate (Promega, 1:2,000) or anti-Mouse IgG HRP Conjugate (Promega ...
-
bioRxiv - Physiology 2022Quote: ... 1:1000 mouse anti-ATP1A1 followed by 1:2500 goat anti-mouse HRP-conjugated secondary (catalog #: W4021; Promega). p-ATP1A1Y260 and ATP1A1 bands were visualized with SuperSignal Pico utilizing the ChemiDoc.
-
bioRxiv - Immunology 2020Quote: ... the membrane was incubated with HRP-conjugated goat anti-rabbit IgG diluted 1:2000 (Promega, Madison, Wisconsin, USA) for 2 h at RT ...
-
Adaptation of CD4 in gorillas and chimpanzees conveyed resistance to simian immunodeficiency virusesbioRxiv - Microbiology 2024Quote: ... membranes were reblotted to detect β-actin expression using primary (Cell Signal #3700) and secondary-HRP (Promega #W402B) antibodies and developed as described.
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 100 uL of the diluted lysate was added to each well along with an equal volume of Caspase Glo 3/7 assay reagent (Promega, Madison, Wisconsin, USA), according to the manufacturer’s directions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... membrane integrity (CytoTox-OneTM homogeneous membrane integrity assay kit: lactate dehydrogenase (LDH release) and caspase activity/ apoptosis (Caspase-Glo® 3/7 assay system kit) (all from Promega, WI, USA), as described previously17 (see Supplementary data for detailed description).
-
bioRxiv - Cancer Biology 2024Quote: ... Dyclonine hydrochloride for 7 days and cell viability was detected by Cell Titer-Glo Luminescent Cell Viability Assay Kit (Promega, catalog number: G7573).
-
bioRxiv - Plant Biology 2020Quote: ... an immunoblot with anti-halo antibody (Anti-HaloTag® Monoclonal Antibody-Promega) was performed to confirm protein expression and binding efficiency for each TF ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used are anti-HaloTag monoclonal antibody (Promega, G921A, 1:1000), and polyclonal rabbit antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... was used in a 1:1000 dilution and horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary IgG (W401B, Promega) was used in a 1:20,000 dilution ...
-
bioRxiv - Immunology 2023Quote: ... Anti-HiBiT antibody (Promega) was used as a positive control for each peptide ...
-
bioRxiv - Biophysics 2023Quote: ... The secondary antibody (Promega: anti-rabbit #W4011 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Secondary Antibody (Promega PRW4011), and 1-Step™ Ultra TMB-Blotting Solution (Invitrogen™ 37574 ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). For siRNA tests ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). Cells were routinely tested for mycoplasma using a MycoAlert detection kit (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and further incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Microbiology 2022Quote: ... washed three times (10 minutes each) with PBST before incubation for 1 h with α-Mouse IgG HRP Conjugate (Promega) secondary antibody (1:10 000 in PBST) ...
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and were then incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
Adaptation of CD4 in gorillas and chimpanzees conveyed resistance to simian immunodeficiency virusesbioRxiv - Microbiology 2024Quote: ... Secondary antibodies were diluted in blocking buffer and incubated with the membrane for 60 min at room temperature (1:10,000 anti-rabbit-HRP, Promega #W401B). After secondary antibody incubation ...
-
bioRxiv - Microbiology 2023Quote: ... Antibodies were visualized by using anti-rabbit immunoglobulin G-alkaline phosphatase secondary antibodies (Promega) and the CDP-star detection system (Roche Diagnostics ...
-
bioRxiv - Genetics 2020Quote: ... Secondary antibodies were from Promega (catalog nos ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cell Biology 2020Quote: ... Mcm2-7 was probed with polyclonal UM174 (gift from Bell lab, MIT - (Chen and Bell, 2011)) and anti-rabbit HRP conjugate secondary (Promega W401B), tubulin was probed with monoclonal anti-tubulin antibody (Sigma T5168 ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times in TBST for 15’ per wash and incubated 1 hour in HRP-conjugated anti-rabbit (Promega, W4011) or anti-mouse (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein detection was done using primary antibody anti-HaloTag monoclonal antibody (1:1,000 dilution, Promega), primary antibody anti-MamE polyclonal antibody (1:3,000 dilution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Secondary antibodies used included alkaline phosphatase-conjugated anti-rabbit IgG antibody (1:1,000, #S3738, Promega) and anti- mouse IgG antibody (1:1,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Bound antibodies were detected using the appropriate horseradish peroxidase-conjugated secondary antibodies (1:10000, Promega). Chemiluminiscent signals were detected with an ECL Prime Western blotting detection kit (GE Healthcare ...
-
bioRxiv - Plant Biology 2022Quote: ... for 2 h as primary antibody and peroxidase-conjugated goat anti-rabbit antibody (1:10,000; Promega) for 1 h with 5 times 10 min washes in-between the incubations ...