Labshake search
Citations for Promega :
551 - 600 of 4778 citations for 7 3 2 3 5 dihydroxyphenyl 2 hydroxyethyl amino propyl 3 7 dihydro 1 3 dimethyl 1H purine 2 6 dione monohydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then incubated for 3 days and viability was assessed using CellTiter- Glo assay (Promega, G7572) following manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cell pellet (on ice) was resuspended in 3 ml Red Blood Cell Lysis Solution (Promega, Z3141) for 4 min and span down for 5 min at 300g in a pre-cooled centrifuge.
-
bioRxiv - Cancer Biology 2021Quote: ... samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... and then lung lobes were inflated with 3% (w/v) 45°C prewarmed low-melting agarose (Promega). The inflated lung lobes were immediately removed and cooled on ice for 15 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’UTR-Nogo-A-wt product was subcloned into both the pGEM-T-easy plasmid (Promega) and the pBKS plasmid (pBluescript ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclear pellets obtained after centrifugation at 1,500g for 3 min were lysed in Reporter lysis buffer (Promega), passed through a 21Gneedle and incubated on ice for 10 min before centrifugation at 17,000g ...
-
bioRxiv - Genetics 2020Quote: ... for 3 hours at 37°C in the presence of RNasin Ribonuclease Inhibitor (Promega #N2111, Madison, WI), and PE2 mRNA was purified with MEGAclear™ Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: Genomic DNA extracted from 3 ml fresh EDTA-blood (wizardR Genomic DNA purification Kit, Promega, Madison, WI) was used for genotyping ...
-
bioRxiv - Developmental Biology 2019Quote: ... plus the full-length 3□UTR of KIF18A in the psiCheck2 dual luciferase vector system (Promega, Germany) in 10:1 (plasmid DNA:luciferase vector ...
-
bioRxiv - Cell Biology 2020Quote: ... bound proteins were alkylated and digested with endopeptidase Lys-C (Wako) for 3 hours and trypsin (Promega) on beads overnight at 37°C.
-
bioRxiv - Developmental Biology 2021Quote: ... the full length of wnt4 including 3’-UTR was cloned into pGEM-T easy vector (Promega, A1360) by primers 5’-ATGTCATCGGAGTATTTGATAAGG-3’ and 5’-AGTCTTTGACACAGCATATATTTC-3’ from cDNA ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... Relative cell growth at day 3 was evaluated by CellTiter-Glo Luminescent Cell Viability Assay (Promega, #G7571). The concentration of inhibitor required for 50% inhibition of cell viability (IC50 ...
-
bioRxiv - Immunology 2023Quote: ... VP1-3 proteins were then bound to the S-Trap column and digested with trypsin (Promega Corporation) for 2 hrs at 47°C ...
-
bioRxiv - Immunology 2023Quote: Proteasome activity was measured in cell lysates using the Proteasome-Glo™ 3 Substrate System (Promega, G8531). Corresponding reagents for testing as chymotrypsin-like ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were adjusted to 3 mM EDTA and digested with 1.0 μg Trypsin/LysC mix (Promega #V5073) for 1 h at 37 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were first transfected with 3′UTR luciferase constructs (10 ng) using FuGENE HD transfection reagent (Promega) for 4 hours then transfected with Dharmacon miR-199a-5p mimic (50 nM ...
-
bioRxiv - Physiology 2021Quote: ... allowing measurement of 2-deoxyglucose-6-phosphate using the Glucose Uptake-Glo assay (Promega) and a FLUOstar Omega luminescence plate reader.
-
bioRxiv - Cancer Biology 2021Quote: ... DNA:FuGENE complexes were formed at a ratio of 1:3 (μg DNA/μL FuGENE HD) according to the manufacturer’s protocol (Promega, Madison, WI, USA). The resulting transfection complex (1 part ...
-
bioRxiv - Microbiology 2019Quote: ... The next day they were transfected over 24 hours with a DNA-Fugene HD mixture at a ratio of 1 μg DNA to 3 μl Fugene (Promega, Southampton, UK) according to the manufacturer’s instructions (Western analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with 1 µg of DNA diluted in 45 µl dMEM and then mixed with 3 µl ViaFect™ (Promega, USA) transfection reagent added and incubate for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... approximately 200,000 HEK-293T cells were transfected with 1 μg of plasmid DNA complexed to 3 μL of FuGENE HD (Promega, Cat: E2311). 16-20 hours post transfection the cells were dissociated from the plastic using cell dissociation buffer (Gibco Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 µl RNase Inhibitor (Promega N2611) and 300 µl 5% IGEPAL ...
-
bioRxiv - Immunology 2021Quote: ... SIV pseudovirus Env construct was cotransfected with env-deficient backbone plasmid (pSG3ΔEnv) in a 1:2 ratio with transfection reagent FuGENE 6 (Promega) in HEK 293T cells according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... were transfected 2 days after plating with 1 μg of total DNA with FuGENE 6 transfection reagent (E2691; Promega) at a ratio 1:3.
-
bioRxiv - Genomics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). PCR products were separated following agarose gel electrophoresis ...
-
bioRxiv - Genetics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). The PCR amplicons were applied onto a 2% agarose gel with appropriate controls and markers.
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then diluted 1:7 in Glo Lysis Buffer (Promega) and incubated 1:1 for 5 minutes in the dark in opaque 96 well plates with NanoGlo Substrate freshly diluted 1:50 in NanoGlo Buffer (Promega) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Digests were carried out in 4M urea 100mM HEPES with LysC (Wako, #121-05063, 1/100 (w/w) protease/substrates) for 3 h at 37C and subsequent trypsin digest (Promega, #V5280, 1/100 (w/w) protease/substrates ...
-
bioRxiv - Physiology 2019Quote: ... 2 μL sequencing-grade trypsin (1 μg/μL; Promega) was added for the digestion at 37°C for 12 h ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μl of 1% Digitonin in DMSO (Promega (2%), Cat ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Physiology 2022Quote: ... 2-Deoxyglucose-6-phosphate (2DGP) was measured using a Glucose Uptake-Glo Assay Kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 2-Deoxyglucose-6-phosphate (2DGP) was measured using a Glucose Uptake-Glo Assay Kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2020Quote: ... Reduced proteins were alkylated and trypsin-digested for 1-2 hours in trypsin solution (2 mg/ml sequencing grade porcine trypsin (Promega)/100 mM Tris/10 mM iodoacetamide ...