Labshake search
Citations for Promega :
5801 - 5850 of 6175 citations for Mouse Caprin 1 CAPRIN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: HEK293 cells were cultured as described (Poliakov et al., 2008) and transfected with 1 µg of the appropriate plasmid using FuGENE HD transfection reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... S2-VP10 cells were co-transfected with 0.5 μg of each luciferase reporter plasmid and 1 ng of pRL-SV40 (Promega, E2231) the day after plating (3.45 × 104 cells/well in a 24-well plate ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of RNA used as a template for cDNA synthesis with random primers and ImProm-II reverse transcriptase (Promega).
-
bioRxiv - Microbiology 2022Quote: ... The cells were incubated for 24 hrs at 37 °C (for HEK-293T) or 39 °C (DF-1) and luciferase activity was measured by using the Dual-Glo luciferase assay system (Promega). The polymerase activity was calculated by normalising firefly luciferase activity relative to the Renilla luciferase activity.
-
bioRxiv - Plant Biology 2022Quote: ... were reduced with DTT and then alkylated with iodoacetamide and digested overnight using Lys-C/Trypsin (1:50, enzyme to protein; Promega). After terminating the digestion with 1% trifluoroacetic acid ...
-
bioRxiv - Plant Biology 2022Quote: ... One microliter of cDNA (corresponding to 50 ng of total RNA) was amplified in 20 μL of reaction mix containing 1× Go Taq qPCR Master Mix (Promega) and 0.5 μM of each primer described in Supplemental Table S2 ...
-
bioRxiv - Microbiology 2023Quote: ... the samples were digested by trypsin with 1/80 (w/w) trypsin/total protein ratio (Sequencing Grade Modified Trypsin, Promega) according to the manufacturer recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was transcribed from 1 ug of MIuI-linearized DNA using T7 RiboMAX Express Large Scale RNA Production System (Promega). Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then diluted with 50 mM NH4HCO3 to a final concentration of less than 2M urea and then and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The samples were then diluted with 50 mM NH4HCO3 to a final concentration of less than 2M urea and then and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR products were purified on a 1% agarose gel and ligated into a pGEM-T Easy Vector Systems (Promega) plasmid followed by transformation in E ...
-
bioRxiv - Plant Biology 2022Quote: ... The coding sequence of nLUC (aa 1-416) and cLUC (aa 398-550) were amplified from pSP-LUC+NF (Promega) and inserted between ApaI and XbaI in pSAT1A-cYFP-N1 (ABRC ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21°C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatant was removed and pellet was resuspended in 400 µL of sort buffer (1 mM EDTA 0.2 U/µL RNase inhibitor (Promega, N211B), 2% BSA (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... QRT-PCR reactions were performed by using the GoTaq®1-Step RT-qPCR System (Promega Scientific, Madison, WI, USA) with Bio-Rad CFX Connect (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated for 1 h at 37 °C with fresh complete DMEM containing JFX646 HaloTag ligand (200 nM; GA112A; Promega), washed twice with PBS 1X and imaged on an Elyra 7 with Lattice SIM² microscope (Zeiss ...
-
bioRxiv - Cell Biology 2024Quote: ... the samples were diluted with seven volumes of 50 mM ammonium bicarbonate and incubated for 16 h at 37 °C with 400 ng of trypsin (ratio 1:50; “Trypsin Gold”, Promega).
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of extracted DNA was added to an amplification mixture containing 1 µl (10 µM) of primers and 12.5 μl of PCR Master Mix Plus (Promega, USA). To each mixture ...
-
bioRxiv - Neuroscience 2024Quote: ... Afterwards the samples were diluted to decrease the concentration of urea up to 1 M and supplemented with additional amounts of sequencing-grade trypsin (Promega) (200 ng for pull-down samples and 1 ug for total lysate samples) ...
-
bioRxiv - Microbiology 2024Quote: ... SL100688) with the exception of BCBL-1 cells that were transfected with FuGENE HD transfection reagent (Promega, Cat. No. E2311,). Competition reporter assays were performed with co- transfection of the TR7 reporter plasmid with or without LANA expression plasmid (DY52) ...
-
bioRxiv - Neuroscience 2024Quote: ... diluted by 4-fold to reduce urea to 2 M for the addition of trypsin (Promega, 1:50 w/w) to continue the digestion at 21ºC overnight ...
-
bioRxiv - Microbiology 2024Quote: ... and the resulting products were checked on agarose gel (1%) and purified using the Wizard SV Gel and PCR Clean-Up System (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Immunology 2024Quote: ... and 1 μg of RNA used as a template for cDNA synthesis with random primers and ImProm-II reverse transcriptase (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: β-arrestin2 recruitment to human chemokine receptors in response to 1 µM VUF15485 or 200 nM positive control chemokines was also monitored by NanoLuc complementation assay (NanoBiT, Promega) (Dixon et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... A 250 ug aliquot was alkylated and digested by incubating overnight at 37 °C in trypsin at a ratio of 1:50 (Promega). Digestion was acidified by adding formic acid (FA ...
-
bioRxiv - Microbiology 2023Quote: ... cells were infected with HIV-1 for 48 hours before luminometric quantification of luciferase activity using the Luciferase Assay System (Promega).
-
bioRxiv - Cancer Biology 2023Quote: ... Alkylated proteins were then cleaved using a two-step digestion: first with Endoproteinase Lys-C (ratio 1:33 enzyme: lysate, Promega) for 1 hour at 37 °C then with Trypsin (ratio 1:33 enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... at a 1:75 enzyme to protein ratio for 6 h at 30 °C and then by trypsin (V5111, Promega) (1:50 enzyme to protein ratio ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Denatured proteins were enzymatically digested for 14 h at 37 °C with 1 µg of sequencing-grade Trypsin (V511A, Promega). After speed-vaccum drying ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was digested overnight at 37 °C with sequencing-grade trypsin or chymotrypsin (Promega; 1:100 protease:protein weight ratio). After desalting on a C18 column (Pierce ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were diluted with 50 mM NH4HCO3 to a final concentration of less than 2 M urea and were further digested overnight with 1:25 (w/w) trypsin (Promega) at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Protein mixtures were diluted in 1:6 ratio (v/v) using ultrapure water prior to digestion using sequencing grade trypsin (Promega) at 37°C for 16 h ...
-
bioRxiv - Immunology 2023Quote: ... Cells were washed once with PBS and lysed for at least 1 h with 40 μl 1x passive lysis buffer (Promega) at RT ...
-
bioRxiv - Microbiology 2022Quote: RT-qPCR analyses of NoV GII were carried out using GoTaq® Probe 1-Step RT-qPCR System (Promega, USA). Primers and the FAM/TAMRA-labelled probe of hNoV GII were according to ISO 15216-1:2017 ...
-
bioRxiv - Microbiology 2023Quote: ... 100 μL of these purified Se cells or 100 μL of the corresponding Se-Ai cocultures were mixed with 100 μL Nano-Glo Luciferase assay reagent (50:1 mixture of substrate:buffer, Promega N1110) in a 96-well plate ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was used to amplify the coding regions of the steroid receptor genes and to linearize the expression plasmids pHTN HaloTag CMV Neo or pFLN-1 NanoLuc (Promega #N1811 ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Neuroscience 2023Quote: ... the washed beads were re-suspended in 150 µl trypsin digestion buffer and incubated for 4 hours with 1 µg trypsin (Promega) at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... Supernatant was removed and pellet was resuspended in 400 µL of sort buffer (1 mM EDTA 0.2 U/µL RNase inhibitor (Promega, N211B), 2% BSA (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples containing 20-30 pmol rhodopsin were mixed with 100-250 fmol BSA and cleaved with 1 μg trypsin/LysC mix (Promega) using the SP3 beads protocol described in [29].
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 40,000 cells per well were seeded into poly-D-lysine-coated 96-well plates (Brand, 781965) and the Halo-ligand was added (1:2,000; Promega, G980A). For each transfection ...