Labshake search
Citations for Promega :
5451 - 5500 of 8253 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: ... All reactions were performed as biological triplicates and technical duplicates using a GoTaq® qPCR Master Mix Kit (Promega). The primers were designed according to the ARG gene sequence (LinJ.35.1490 ...
-
bioRxiv - Zoology 2020Quote: ... Other sections were digested in a mixture of 97% Nuclei Lysis Solution (Promega; from the Wizard DNA isolation kit) and 3% 20mg/ml Proteinase K (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: gDNA samples for library preparation were extracted from overnight LB cultures using the Wizard Genomic DNA Purification kit (Promega) as described above ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reactions were stopped by addition of TFA to 0.1% and the production of SAH was measured using the MTase-Glo Methyltransferase Assay kit (Promega) according to the manufacturer’s instructions using a Hidex Sense microplate reader..
-
bioRxiv - Cancer Biology 2020Quote: ... Forty-eight hours post transfection (or twenty-four hours for promoter truncation/mutation) dual-luciferase reporter assay kit (Promega) was used to analyze bioluminescence on SpectraMax i3x microplate reader (Molecular Devices ...
-
bioRxiv - Molecular Biology 2020Quote: ... ZmIBH1-1 was fused to HaloTag using the kit from pFN19K HaloTag T7 SP6 Flexi Vecto (cat#G184A) (Promega). ZmCLA4 fused to HaloTag was expressed using the TnT SP6 High-Yield Wheat Germ Protein Expression System (L3260 ...
-
bioRxiv - Cell Biology 2021Quote: ... Supersignal kit (Pierce) and a LAS-3000 imager (Fujifilm) or AP-coupled antibodies and NBT/BCIP as substrates (Promega). Rabbit polyclonal antibodies obtained and purified using full-length Arpin were previously described (Dang et al ...
-
bioRxiv - Microbiology 2020Quote: ... fLuc activity was measured using a luciferase assay system kit and GloMax® Navigator Microplate Luminometer (both from Promega).
-
bioRxiv - Physiology 2020Quote: ... Blocked membranes were incubated for 2 hours with DNA probe synthesized using a Prime-a-Gene® kit (Promega) and washed in mild and stringent Southern wash buffers ...
-
bioRxiv - Immunology 2021Quote: ... and several sample types were evaluated for ADCC and ADCP functionalities using the corresponding Reporter Bioassay kit (Promega Corporation). ADCC and ADCP induction was expressed as induction ratio (IR) ...
-
bioRxiv - Biochemistry 2021Quote: Caspase-3/7 activity was quantified by fluorometric assay using ApoONE Homogeneous Caspase-3/7 Assay Kit (Promega, US). AU565 cells ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3βHSD and FSHR in the supernatant of cultured GCs were quantified using GoTaq® qPCR Master Mix Kit (Promega) as previously described [29] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA was extracted from clinical samples (300μl) via a Maxwell 48 device using the Maxwell RSC Viral TNA kit (Promega) with a viral inactivation step using Proteinase K ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was isolated from whole mount larvae or dissected tissue using the Maxwell RSC simplyRNA Tissue kit (Promega Corp. ...
-
bioRxiv - Genomics 2021Quote: ... We extracted the total RNA of the larval stage using ReliaPrep RNA Tissue Miniprep kit (Promega, Madison, WI/USA) according to the supplier’s recommended protocol ...
-
bioRxiv - Immunology 2020Quote: ... The culture supernatants were collected and analysed for lactate dehydrogenase (LDH) by a commercially available CytoTox 96 Non-radioactive Cytotoxicity Assay kit according to the manufacturer’s (Promega) instructions ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from filter paper punches using the manufacturer’s protocol for Promega Maxwell DNA IQ Casework Sample kit (Promega) or Qiagen DNA Blood kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... lactate dehydrogenase (LDH) was measured from leukocyte supernatants using CytoTox 96 Non-Radioactive Cytotoxicity kit (Promega; Cat. No. g1780) per manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... lactis CICC 6242 strain producing nisin A was extracted using a “Wizard Genomic DNA Purification” kit (Promega, Madison, USA). The nisA and nisRK genes were amplified through a polymerase chain reaction using the primers listed in Table 1 [29] ...
-
bioRxiv - Microbiology 2022Quote: The HEV replicon plasmids were linearised with BglII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... Sequences of all plasmids were verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Cat# 063001) with a Spectrum Compact CE System (Promega). The psPAX2-IN/HiBiT plasmid was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction was performed with the Maxwell RSC PureFood GMO and Authentication kit using a Maxwell RSC instrument (Promega France ...
-
bioRxiv - Microbiology 2022Quote: pSK-E2-nLuc replicon plasmid was linearised with BglII and pUC-HEV83-2 replicon plasmid was linearised with HindIII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... The ATP concentration was measured using an ENLITEN ATP Assay System with a bioluminescence detection kit (Promega, Madison, WI). Briefly ...
-
Throat colour polymorphism in relation to sex and body size of the Litter skink, Lankascincus fallaxbioRxiv - Zoology 2022Quote: ... black and white throat colored individuals using Promega Wizard® genomic DNA purification kit (Promega Corporation, Madison, Wisconsin, USA) following manufacturer’s protocols ...
-
bioRxiv - Immunology 2023Quote: ... Renilla luciferase internal control vector pRL-TK and the dual luciferase reporter assay kit were from Promega (Madison, WI). Phusion PCR enzyme ...
-
bioRxiv - Cancer Biology 2024Quote: ... The identity of each cell line was confirmed by DNA fingerprinting via short tandem repeats at the time of mRNA and total protein lysate preparation using the PowerPlex 1.2 kit (Promega).
-
bioRxiv - Neuroscience 2024Quote: ... Blood and iPSC genomic DNA were extracted through Promega Wizard™ Genomic DNA Purification Kits (Promega, Madison, WI, USA). Array comparative genome hybridisation (array-CGH ...
-
Identification of echinacoside as a tobramycin potentiator against Pseudomonas aeruginosa aggregatesbioRxiv - Microbiology 2024Quote: Genomic DNA from different isolates was obtained from pelleted overnight cultures using the Wizard Genomic DNA purification kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... DNA of plant selected at this stage was extracted from rosette leaves using Wizard Genomic DNA Purification kit (Promega) and digested with methylation-sensitive restriction enzyme (MspI or CfoI ...
-
bioRxiv - Plant Biology 2024Quote: ... The complete amount of RNA was reverse transcribed to cDNA using the oligodT from the GeneRacer kit and following the manufacture’s guide of ImProm-II Reverse Transcriptase (Promega). The PeSPL6 and PeSPL13a 5’-ends were amplified by PCR using the GoTaq Master mix (Promega) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All amplicons were then verified by gel electrophoresis and purified using a Wizard Gel Purification kit (Promega, Madison, WI).
-
bioRxiv - Microbiology 2023Quote: ... UTI-59 DNA for long-read sequencing only was extracted using the Wizard HMW DNA Extraction Kit (Promega, USA) following the manufacturer’s instructions excepted eluted in molecular grade water ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid sequence was verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
-
bioRxiv - Neuroscience 2023Quote: RNA from lyophilized cerebrum and brainstem samples was extracted using the Maxwell® RSC simplyRNA Tissue Kit/Instrument (Promega) with initial homogenization on a TissueLyser LT (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from FFPE samples (Discovery Cohort) using Maxwell 16 LEV RNA FFPE Kit (Promega, Madrid, Spain), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: NAD+ and NADH measurements were done with the NAD/NADH-Glo Assay Kit (#G9071 from Promega, Madison, WI, USA). Cells were grown in 24-well plates ...
-
bioRxiv - Molecular Biology 2023Quote: ... Caspase CP and CAEC apoptosis was determined after treatment with hemin or vehicle using a Caspase glo kit (Promega) according to manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1-2 μg) was reverse transcribed with a GoScriptTM Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation ...
-
bioRxiv - Bioengineering 2024Quote: ... The hDF metabolic activity was measured with the CellTiter 96 ® Aqueous MTS Kit (Promega Corp., Madison, WI, USA). At each timepoint ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... cDNA was generated from 1 μg total RNA per sample using the M-MLV Reverse Transcriptase kit (M1705, Promega). To detect RNA transcript of targeted genes ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were stimulated on the next day and lysed after 24 hrs following manufacturer’s protocol in Dual Luciferase Assay kit (Promega). Luminance signal readings were performed using or SpectraMax i3x (Molecular Devices) ...
-
bioRxiv - Microbiology 2022Quote: ... [32P]-dCTP labelled hmbA and 18S rRNA gene-specific DNA molecules were used as gene probes using the random hexanucleotide-primer kit following the supplier’s instructions (Promega). As a loading control ...
-
bioRxiv - Microbiology 2022Quote: ... PPMP was assessed for cytotoxicity at the indicated concentrations with a CytoTox96 non-radioactive cytotoxicity colorimetric assay kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... the samples were thawed and aliquoted in technical duplicates for detection of firefly and renilla luciferase activity using the Dual-Luciferase Reporter Assay kit using the GloMax luminometer to the manufacturer’s specifications (Promega). Promoter activity was determined by normalising firefly luciferase values to renilla luciferase values and expressed as relative light units (RLU).
-
bioRxiv - Microbiology 2022Quote: PCR amplicons were gel extracted using the QIAquick gel extraction kit and ligated into pGEM-T Easy plasmid (Promega). Vectors containing the PCR products were then cloned into chemically competent E ...
-
bioRxiv - Neuroscience 2023Quote: ... the luminescence detection assay was performed following all the manufacturer’s recommendations (Dual-Luciferase Reporter Assay Kit System E1910 (Promega).
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total RNA was extracted using the Maxwell® RSC instrument together with the Maxwell® simplyRNA Tissue Kit (Promega) according to the manufacturer’s instructions with a final elution volume of 60 μl ...