Labshake search
Citations for Promega :
501 - 550 of 3920 citations for Rat Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... the GoScript Kit (Promega) was used to make cDNA and qRT-PCR performed on a BioRAD c1000 Touch thermocycler.
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Genomics 2019Quote: ... Alternatively, ¼ of an agarose plug was soaked in GET solution (3% 2-mercaptoethanol, 0.5x QuantiFluor® dye (Promega), 1X TBE ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Microbiology 2020Quote: NCIMB8209 DNA was isolated using a commercial kit (Wizard Genomic DNA purification kit, Promega), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... column purification kits or Maxwell 16 LEV simplyRNA Purification Kits (Promega, Madison, WI, USA) and prepared cDNA libraries using TruSeq RNA Library Prep Kit (Illumina ...
-
bioRxiv - Zoology 2022Quote: DNA was extracted with several different kits: the Wizard Genomic DNA Purification kit (Promega), the Qiagen Blood & Tissue kit ...
-
bioRxiv - Microbiology 2019Quote: The luciferase assay kit (Promega) was used to test the expression and regulation performance of the selected transactivator-positive clones ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase3 / 7 Kit (Promega company).
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Immunology 2019Quote: ... Access RT-PCR kit (Promega) was used for characterization of recombinant influenza viruses.
-
bioRxiv - Microbiology 2019Quote: ... Wizard gDNA Purification Kit (Promega) was used to isolate and purify gDNA from CEM-SS cells.
-
bioRxiv - Cancer Biology 2019Quote: ... The dual luciferase kit (Promega) was used to measure activity using a luminometer ...
-
bioRxiv - Plant Biology 2020Quote: ... A Dual Luciferase kit (Promega) was used to detect reporter activity ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primers Kit (Promega, A2800) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gaussia luciferase kit from Promega was used for detecting secreted Gaussia luciferase signal as per manufacturer’s protocol.
-
bioRxiv - Immunology 2021Quote: ... the commercial AMPGlo kit (Promega) was used according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2021Quote: ... chromosomal isolation kit (Promega (USA)) ...
-
bioRxiv - Plant Biology 2020Quote: ... Oligo dT kit (Promega, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... GoTaq®qPCR kit (Promega) was used for qPCR analysis ...
-
bioRxiv - Genomics 2021Quote: ... PureYield plasmid miniprep kits (Promega), or QIAprep Spin Miniprep kits ...
-
bioRxiv - Cell Biology 2022Quote: ... The MTT assay kit (Promega) was used according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: GoTaq DNA polymerase kits (Promega) were used for PCR reactions ...
-
bioRxiv - Genomics 2023Quote: ... the Tunnel staining kit (Promega) was used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... sequencing reaction (fmol kit, Promega) using the same end labeled primer was run to identify the exact position of RT stops.
-
bioRxiv - Neuroscience 2023Quote: ... Oligo (dT) kit (Promega, #A2791) to reverse transcribe the RNA into cDNA following the manufacturer protocol.
-
bioRxiv - Microbiology 2023Quote: ... Reverse Transcription Kit (Promega, USA); IBV nucleic acid amplification fluorescence detection kit (Shanghai Furex Medical Scientific and Technological Development Co. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Core Kit (Promega, Wisconsin, USA), following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: Gently re-suspend cells in 100 μl of 3% Glyoxal fixation solution with 1:25 RNasin Plus (Promega N261B) and incubate for 15 minutes on ice.
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was quantified to 3 μg to react 1 μg/μL random hexamer (C1181; Promega, Madison, WI, USA) at 70°C for 5 min ...