Labshake search
Citations for Promega :
501 - 550 of 6889 citations for Mouse Translational Activator Of Cytochrome C Oxidase 1 TACO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Molecular Biology 2021Quote: ... AntiHaloTag (mouse monoclonal, Promega G9211) blot (Figure 1B ...
-
bioRxiv - Physiology 2024Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Cell Biology 2023Quote: ... or anti-mouse HRP (Promega) was diluted in TBST containing 5% dried nonfat milk ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse anti-HaloTag (Promega, G921A), rabbit anti-DDX6 (Bethyl ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-HaloTag (Promega, G9211); rabbit anti-CIMPR (made in house) ...
-
bioRxiv - Cell Biology 2023Quote: ... Halo-Tag (Promega, G9211, mouse), and HSP90 (Santa Cruz Biotechnologies ...
-
bioRxiv - Cell Biology 2024Quote: ... or anti-mouse (Promega, W402B) secondary antibodies (1:3000 ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Microbiology 2019Quote: ... Samples were then diluted 4-fold with 100 mM Tris HCl pH 8.5 to reach a concentration of 2M urea and then re-incubated overnight at 37°C with 1 µg Sequencing Grade Modified Trypsin (Promega, Madison, WI, USA). A second incubation with the same amount of trypsin (5 h at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets were reconstituted and digested with endoproteinase Lys-C (Alpha Laboratories, UK) for 1 hour at room temperature and trypsin (Promega, Madison, WI, USA) overnight at 35°C.
-
bioRxiv - Biochemistry 2021Quote: ... Tryptic samples were subsequently diluted to 2M urea in 100mM Tris/HCl pH 8 and digested over night at 37°C (Promega, enzyme:protein 1:100). Samples were adjusted to pH 2 using 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Bioengineering 2023Quote: ... Reverse transcription was performed at 70 °C for 5 min and 42 °C for 60 min with 1 µg total RNA using ImProm-II reverse transcriptase (Promega, Madison, WI, USA) and 250 ng oligo(dT)12-18 primers (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... 35S-methionine-labeled Ctb or its derivatives were produced in coupled in vitro transcription and translation reaction (IVTT, at 30 °C for 1 h) using TNT Quick Coupled Transcription/Translation System (cat#L1170, Promega, Madison, WI, USA). Prey proteins were diluted in binding buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were first digested for 5 h at 37 °C with 500 ng rLys-C Mass Spec Grade (Promega, Madison, WI, USA) before being diluted 4-fold with 100 mM Tris HCl pH 8.5 to reach a concentration below 2 M urea ...
-
bioRxiv - Biochemistry 2021Quote: ... and alkylated with iodoacetamide to a final concentration of 15 mM for 30 min at 37 °C in a dark environment with Lys-C (Promega, Cat # V1671) at a 1:100 (wt/wt ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were then digested overnight at 35ºC using Trypsin/Lys-C (Trypsin/Lys-C Mix, Mass Spec Grade, Promega, Cat No: V5072); the enzyme-substrate ratio of 1:70) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Digestion was performed in the S-Trap overnight at 37°C using Trypsin/Lys-C Mix Mass Spec Grade (Promega, Walldorf, Germany), followed by elution in 50 mM TEAB ...
-
bioRxiv - Microbiology 2022Quote: ... washed three times (10 minutes each) with PBST before incubation for 1 h with α-Mouse IgG HRP Conjugate (Promega) secondary antibody (1:10 000 in PBST) ...
-
bioRxiv - Plant Biology 2021Quote: ... antibodies before probing with horseradish peroxidase (HRP)-conjugated anti-rabbit (for H3) or anti-mouse (for anti-GFP and anti-TUB) as the secondary antibody (1:5000; Promega, Madison ...
-
bioRxiv - Microbiology 2020Quote: ... used at a 1:10,000 dilution and the secondary antibody was an Anti-Mouse IgG HRP conjugate antibody (Promega, #W4021) used at a 1:10,000 dilution.
-
bioRxiv - Microbiology 2020Quote: ... the plates were washed with PBS-T five times and added with a 1:5000 dilution of HRP-conjugated goat anti-mouse IgG antibody (Promega) in blocking buffer at 37 °C for 45 min ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were washed in 1×PBST and then incubated with the secondary antibody (anti-rabbit or anti-mouse IgG conjugated with horse radish peroxidase at 1:10 000, Promega). The membranes were then revealed using an ECL kit (GE Healthcare ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were revealed using species-appropriate HRP-conjugated secondary antibodies (anti-rabbit or anti-mouse IgG (1:5000, Promega), or anti-guinea pig IgG (1:5000 ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were digested with rLys-C (#V1671, Promega, France) ratio 50:1 (protein:rLysC ...
-
bioRxiv - Genetics 2021Quote: ... Samples were then digested overnight with rLys-C (Promega), the peptides were cleaned on a Supelco Visiprep SPE Vacuum Manifold (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Modified trypsin/Lys-C was from Promega (Madison, WI). Poros R2 and Poros Oligo R3 reversed-phase material were from Applied Biosystems (Forster city ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were digested first by Lys- C (Promega, USA) at RT for 2 hours ...
-
bioRxiv - Genetics 2022Quote: ... 0.5 µg of Trypsin/Lys-C Mix (Promega, U.S.A.) was added ...
-
bioRxiv - Biochemistry 2022Quote: ... MS-grade trypsin/Lys-C mix (200 ng, Promega) in 25 mM Tris-HCl (pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... or a combination of trypsin and Glu-C (Promega); aliquots of etanercept proteins were digested respectively using trypsin (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... or a combination of Glu-C and AspN (Promega). For the analysis of deglycosylated glycopeptides ...
-
bioRxiv - Neuroscience 2023Quote: ... After overnight digestion using Trypsin/Lys-C (Promega, #V5073), supernatant was collected from the magnetic beads ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Trypsin/Lys-C Mix (Promega, Madison, WI, USA) at a 1:50 ratio in a ThermoMixer C (Eppendorf ...
-
bioRxiv - Molecular Biology 2024Quote: ... Trypsin/Lys C was purchased from Promega (Madison, USA). ITO slides were obtained from Delta technologies (Loveland ...
-
bioRxiv - Microbiology 2024Quote: ... and pBiT2.1-C[TK/SmBiT] were obtained from Promega. ALTO ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were digested using trypsin/ Lys-C mixture (Promega) and desalted on a 10 x 4.0 mm C18 cartridge (Restek ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.5 µg of trypsin/Lys-C mixture (V5073, Promega) added to each on-bead sample and set to rotate head-over-head overnight at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... After overnight digestion with Trypsin/Lys-C mix (Promega), peptides were transferred ...
-
bioRxiv - Developmental Biology 2023Quote: ... Proteins were digested first by Lys-C (Promega, USA) at RT for 2 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... and limited digestion by Trypsin/Lys-C Mix (Promega). The samples were then extracted by ethyl acetate ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μg cellular RNA was treated with DNase (RQ1 Rnase-Free DNase kit Promega) and reverse-transcribed following the GoScript ™ Reverse Transcriptase Kit (Promega ...
-
bioRxiv - Systems Biology 2024Quote: ... coagulans DSM 1 = ATCC 7050 was extracted using Wizard Genomic DNA Purification Kit (Promega) according to the protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and the 200 nM GoTaq® Probe 1-Step RT-qPCR System Kit (Promega). This kit uses GoTaq Probe qPCR Master Mix with dUTP (10 uL) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pellets were washed twice with ice-cold ethanol followed by overnight incubation at 37°C in 100 mM ABC containing 1 mM CaCl2 and trypsin (Sequencing grade, modified, Promega Co, Madison, WI, USA). Digested proteins were evaporated and each sample was freed from salts and buffers by solid-phase extraction on C18 resin using cartridges prepared in-house ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted with ABC to a final concentration of 1 M urea and digested using trypsin (Promega, V5113; 3 μg/mL, 37°C, 16 h). After digestion ...