Labshake search
Citations for Promega :
501 - 550 of 2107 citations for Ethyl 5 2 3 difluorophenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay Virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system (RNA1 qPCR primers GW194 and GW195)23.
-
bioRxiv - Systems Biology 2023Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2023Quote: ... After incubation at 37 °C/5 % CO2 for 20 h 40 nl HaloTag® NanoBRET™ 618 Ligand (PROMEGA) was added to the cells using an Echo acoustic dispenser (Labcyte ...
-
bioRxiv - Immunology 2023Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... DNA from My-La cells was amplified by use of primers GATA3_AICE_KpnI s 5’-GCGGTACCATACAGACCCTTCCAGCCAC and GATA3_AICE_XhoI as 5’-GCCTCGAGAACAGATGTGGGGAGTCAGA and cloned via KpnI and XhoI into the multiple cloning site (MCS) of pGL3 (Promega). All constructs were verified by sequencing.
-
bioRxiv - Immunology 2023Quote: Promoter constructs were created by cloning the immediate 4.5-kb region adjacent to the 5’ TSS of SPINK7 into the promoterless Nano-luciferase reporter vector pNL1.1-NL (Promega). The 4.5-kb sequence and subsequent constructs were created by using primers with the restriction enzyme sites KpnI-HF and XhoI ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... beads were reconstituted in 5 μL 50 mM HEPES pH 8.0 buffer containing trypsin/rLys-C enzyme mix (Promega) at a 1:25 enzyme to protein ratio ...
-
bioRxiv - Biophysics 2024Quote: ... The next day cells were treated with compounds and assessed for cell growth 5 days later using CellTiterGlo (Promega).
-
bioRxiv - Cell Biology 2024Quote: ... 5 regions of ieCTNNB1 and the region containing the mutation site were respectively cloned into pGL3- promoter vector (Promega). HEK293T ...
-
bioRxiv - Neuroscience 2024Quote: ... Transfection was performed at ∼5 DIV after half-replacing the medium with fresh proliferation medium using Fugene 6 (Promega) with the following ratio ...
-
bioRxiv - Systems Biology 2024Quote: ... Proteins were digested with 5 µL of 100 mM Ambic pH 8.8 that contained ∼250 ng/µL of Trypsin/rLysC enzyme mix (Promega) (Total amount 1.25 µg ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using primers listed in Supplementary Table 5 and products cloned using the pGEM-T Easy Vector System I (Promega) or Phusion HF DNA polymerase (NEB ...
-
bioRxiv - Immunology 2024Quote: ... plates were washed 5 times with wash buffer (PBS with 1% BSA (Capricorn Scientific) and 0.05% Tween-20 (Promega)) ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were trypsinized on beads in 100 μL of digestion buffer (1 M urea, 50 mM Tris-HCl, pH 7.5, and 5 μg/mL trypsin (V5111, Promega)) ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein digestion was carried out in digestion solution (5 ng trypsin/μl in 50 mM ABC, 10% ACN, 0.01% (m/v) ProteaseMAX surfactant (Promega), 1 mM CaCl2 ...
-
bioRxiv - Cell Biology 2024Quote: Column-bound proteins were washed in Binding buffer and then digested with 5 µg of 0.8 µg/µL trypsin solution (Promega) diluted in Digestion buffer (50 mM TEAB at pH 8.5) ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Microbiology 2024Quote: ... A 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based viability assay (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega) was performed as previously described (25).
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and further incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were digested overnight at 37 °C with 5 μL of trypsin (1 μg dissolved in 50 mM HEPES pH 8.0, Promega V5111). The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 μg of each protein was then boiled in PCR tubes at 100 °C for 5 min and allowed to cool to room temperature before 1 μg mass spectrometry-grade trypsin (Trypsin Gold from Promega) was added to each sample ...
-
bioRxiv - Neuroscience 2021Quote: IP and pull-down probes of DG NSCs were subjected to on-bead digestion (Hubner et al., 2010) by trypsin (5 µg/ml, Promega) in 1.6 M Urea / 0.1 M Ammonium bicarbonate buffer at 27 C for 30 minutes ...
-
bioRxiv - Genomics 2020Quote: ... 500 cells were plated in each well of 96-well-plate and each sample had 6 replicates and monitored for 6 days from day 0 to day 5 by CellTiter-Glo 2.0 Assay (Promega, G9242) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 40% confluent HAP 1 WT cells (seeded in a 10-cm dish) were co-transfected with the two plasmids described above (5 µg each) using 30 µl Fugene6 transfection reagent (Promega) in OptiMEM medium ...
-
bioRxiv - Cell Biology 2020Quote: ... Remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 150 ng trypsin (Trypsin Gold, Promega) at room temperature for 90 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 pmols of folded pre-tRNA substrate was incubated with a final concentration of 5 U ml−1 RNasin plus inhibitor (Promega), 5 mM ATP and 8 pmols of TSEN complex in a final reaction volume of 20 μl for 1 h at 30 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... Ligations of the digested plasmid backbones and PCR products occurred for 5-10 minutes at RT using T4 DNA ligase (Promega) prior to transformation into NEB® Turbo Competent E ...
-
bioRxiv - Biochemistry 2021Quote: The samples were reduced and digested in 25 μL co-IP digest buffer (50 mM Tris-HCl, 5 ng/μL trypsin (sequencing grade, modified, Promega), 2 M urea ...
-
bioRxiv - Cancer Biology 2020Quote: ... the blot was blocked with either 5% nonfat-milk or 5% BSA in TBST before addition of primary antibodies and followed with peroxidase-conjugated secondary antibody (Promega). Protein bands were detected using SuperSignal Chemiluminescent Substrate (Pierce ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 and 6 d using a CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (G3582; Promega, Madison, WI). Cells were incubated with the MTS reagent 3-4 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and were then incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... Halo fusion proteins were produced from 1.5 µg plasmid DNA in a 15 µL reaction using TNT SP6 High-Yield Wheat Germ Protein Expression System (Promega). Protein expression was confirmed by Western blot with Anti-HaloTag monoclonal Ab (1:2000 ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were sonicated for 30 seconds before centrifugation and 5 μl of the supernatants were collected for luciferase expression reading by the dual-luciferase reporter assay system (Promega) using a GLOMAX 20/20 luminometer (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... cells13 for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR mixture was at a volume of 10 μL containing 5 μL SYBR Premix Ex Taq (Promega, Madison, USA), 0.5 μM each of the primers ...
-
bioRxiv - Cell Biology 2021Quote: ... the antibody–bead mixture was resuspended in 500 μl of the reaction mixture containing 10 μg of fragmented total RNA,100 μl of reaction buffer and 5 μl of RNasin Plus RNase Inhibitor (Promega), and incubated for at least 4 h at 4 °C ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM EGTA, 5% glycerol) and freshly supplemented reagents (1 mM DTT, 1 mM ATP, 1 mM PMSF, protease inhibitor mix (Promega) and 1% Tween 20) ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were digested to peptides by addition of 25 μl of 50 mM ammonium bicarbonate containing 5 μg of trypsin (Promega) and incubating (37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 150 ng trypsin (Trypsin Gold, Promega) for 90 min at room temperature in the dark ...
-
bioRxiv - Biochemistry 2022Quote: ... Remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 200 ng trypsin (Trypsin Gold, Promega) at 37 °C ON ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were diluted with ddH2O 1:5 and proteins were digested for 20 h at 37°C using trypsin (Trypsin Gold, Promega) at an enzyme/protein ratio of 1:50 ...
-
bioRxiv - Biochemistry 2022Quote: ... which had been pre-incubated in 200 μL Ex-Cell 420 medium plus 5 μL FuGENE HD transfection reagent (Promega) for 20 minutes at 27 °C ...
-
bioRxiv - Immunology 2022Quote: ... cells9 for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Immunology 2022Quote: ... for 48 h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of the purified RNA was further treated in solution by 5 units of RQ1 DNase in 100 μl of 1x RQ1 buffer (Promega) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: The genomic DNA of the 5 assessed M strains were isolated and purified using the Wizard Genomic DNA Purification Kit (Promega). The growing of strains ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole mount in situ hybridization was performed as previously described 55 with the following modifications: 5 dpf larvae were permeabilized by digesting with Proteinase K (10ug/ml, Promega) for 2 hours ...