Labshake search
Citations for Promega :
501 - 550 of 2234 citations for 6 FLUORO 2 METHYL 3 4 PIPERIDINE 1H INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... retroviral plasmid was transfected to HEK293 cells using FuGENE 6 (Promega, E2692). Two days after transfection ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... 50 ng PPRE X3-TK-luc and 6 ng pRL-SV40 (Promega), in the presence of the Fugene HD transfection reagent (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.2 µg p8.91 and 1.2 µg KAP1 pHRSIN using FuGENE 6 (Promega). Virus-containing supernatant was collected 48 h post-transfection ...
-
bioRxiv - Microbiology 2021Quote: ... Viral stocks were generated by transfecting 293T cells using Fugene 6 (Promega). After 48h ...
-
bioRxiv - Microbiology 2022Quote: ... The DNA plasmid mix was added to 18µl of Fugene-6 (Promega) transfection reagent in 200µl of pre-warmed Opti-MEM (Gibco ...
-
Receptor-like role for PQLC2 amino acid transporter in the lysosomal sensing of cationic amino acidsbioRxiv - Cell Biology 2020Quote: ... Transfections and co-transfections were performed using FuGENE 6 transfection reagent (Promega). Cells were analysed two days post-transfection.
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T cells were transfected with plasmid DNA using Fugene 6 reagent (Promega) by following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2019Quote: ... cDNA transfections were performed using JetPEI (Polyplus Transfection) or Fugene 6 (Promega) transfection reagents according to manufacturers’ instructions for 24h ...
-
bioRxiv - Cell Biology 2019Quote: ... and 0.2 μg of pMD2.G envelope plasmid using FuGENE 6 (Promega). Cells were incubated up to 48 hrs and then lentivirus-containing media was collected and concentrated with Lenti-X concentrator (Clontech) ...
-
bioRxiv - Microbiology 2021Quote: RSV VLPs were produced by FuGENE® 6 Transfection Reagent (Promega, E2691) transfection of DF1s at 50% confluence with 1 µg of viral plasmid ...
-
bioRxiv - Immunology 2021Quote: ... and HIV Rev plasmid using Fugene 6 transfection reagent (Promega, Madison, WI). Virus-containing medium was titrated to ensure undersaturating conditions for infection of H1299 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... For transient transfection cells were incubated with mixture of FuGene 6 (Promega) and the plasmid of interest ...
-
bioRxiv - Biochemistry 2022Quote: ... was mixed with 10 μL of FuGENE 6 transfection reagent (Promega E2693). After 5 minutes ...
-
bioRxiv - Immunology 2022Quote: ... into 293T cells in DMEM medium + 10% FCS using Fugene 6 (Promega) for pseudoviruses production ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with the plasmid of interest using Fugene 6 transfection reagent (Promega). All shRNA plasmids used were purchased from Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... they were transfected with indicated plasmids using FuGENE 6 transfection reagent (Promega). After another 24h ...
-
bioRxiv - Microbiology 2023Quote: ... in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega). After overnight incubation at 37°C in 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: Plasmid DNA transfections were performed using FuGENE® 6 transfection reagent (Promega). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected using a master mix of Fugene 6 (Promega, E269A) and Optimem (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... HEK293T cells (70% confluent) were transfected using FuGene 6 transfection reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 assay reagents (Promega, WI, USA) were added to each well according to the manufacturer’s instructions (ratio of 1:4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’-UTR derived from pNL1.1[Nluc] vector (Promega), and 50 nt poly(A ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase-Glo® 3/7 Assay System (Promega) was used according to manufacturer’s guidelines ...
-
bioRxiv - Systems Biology 2020Quote: ... and T4 DNA ligase (3 U/μί, Promega) were applied to assemble all of the synthetic promoter blocks sequentially and simultaneously into the firefly reporter vector backbone in a one-pot reaction ...
-
bioRxiv - Cancer Biology 2020Quote: Caspase 3/7 Assay kit (Promega, Southampton, UK) was utilized to assess apoptosis as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Caspase-Glo 3/7 assay (Promega, Madison, WI) (5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Caspase-Glo 3/7 Assay (Promega, Cat# G8090) reagent was added to the cells and incubated for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... by Caspase-Glo® 3/7 Assay (Promega) using GloMax Discover Microplate Reader (Promega).
-
bioRxiv - Neuroscience 2019Quote: ... organoids were embedded in 3% agarose (Promega, #V3125), sectioned at 120-µm thickness and collected in 30% sucrose in 1× PBS for cryopreservation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or Caspase-Glo® 3/7 (Promega, USA) respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... The caspase 3/7 (Caspase-GloTM Promega G8090) level was measured per the manufacturer’s instructions.
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cell Biology 2023Quote: Caspase-Glo 3/7 Assay (Promega, Fitchburg, WI) and ROS-Glo H2O2 Assay (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 3D Assay (Promega, #G8981) was added and the mixture incubated per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The endpoints of the second screen were caspase 3/7 activity measured using the CaspaseGlo® 3/7 assay reagent (Promega) at the 8-hour and 16-hour time intervals ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...