Labshake search
Citations for Promega :
501 - 550 of 1304 citations for 6 CHLOROPURINE RIBOSIDE 5' O MONOPHOSPHATE SODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: HeLa cells were transfected using 2 µg of plasmid DNA and 6 µL of FuGENE (Promega) for gene editing or using a NEPA21 electroporation system (Nepa Gene ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transiently transfected with 1.5 μg of plasmid using FuGENE 6 transfection reagent (#E2692, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 6-8 hours before dual luciferase assay was performed using the Dual-Glo Luciferase Assay (Promega) in a Synergy Neo2 microplate reader (Biotek).
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid transfection of U2OS cells with PIF1 variants was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were plated at 100,000cells in 2 ml media onto 35mm MatTek glass bottom dishes and transfected with 0.9µg RUSH plasmid and 0.1µg eGFP-GalT or LAMP1-GFP using 100µl Opti-MEM and 3µl Fugene 6 transfection reagent (Promega) one day before imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were washed again and 6 µg of plasmid DNA was added with FugeneHD transfection reagent (Promega). Supernatants were collected at 24 ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated for 6 h at 37°C with 3 μg Sequencing Grade Modified Trypsin (Promega). Digestion was terminated via addition of 20 μL trifluoroacetic acid (TFA) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6 uL of RNA was used for each cDNA synthesis (GoScript™ Reverse Transcription System kit, Promega). qPCR was performed using Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... following manufacturer’s guidelines and a ratio of 0.5 µg of plasmid:1.5 µL FuGene 6 (Promega, E2691) in Opti-MEM (Gibco) ...
-
bioRxiv - Biochemistry 2020Quote: ... HeLa cells were transiently transfected with the PX459–sgRNF213-exon3 vector using FuGENE 6 Transfection Reagent (Promega). Forty-eight hours post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection was done on pre-seeded HeLa cells (70% confluency) with the FuGENE 6 Transfection Reagent (Promega) following standard protocol ...
-
bioRxiv - Cell Biology 2022Quote: eGFP-HSP27 immunoprecipitations were performed in p62KO HeLa cells 24hrs following transient transfection using Fugene 6 (Promega). HeLa cells were treated with 750µM LLOMe for 2hrs prior to immunoprecipitation ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Piezo2 (Lewis et al., 2017): 2.5 µg + 0.5 µg YFP) with Fugene 6 (Promega, Madison, WI) 48 hours prior to recording at a transfection ratio of 10 µL Fugene6:3 µg total DNA ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.25 μg vesicular stomatitis virus G glycoprotein expression plasmids using the Fugene 6 transfection reagent (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Developmental Biology 2022Quote: ... in 6-well plates with pActin-Gal4 and pUAS-Lgr4 vector using Fugene-HD (Cat. # E2311, Promega). Twenty-four hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... and then they were transfected with the expression plasmid DNAs by using FuGENE 6 (Promega, Madison, WI).
-
bioRxiv - Cancer Biology 2023Quote: ... into HEK293T cells in 57 µL Opti-MEM and 6 µL FuGENE HD (Promega, Fitchburg, WI, USA) transfection reagent as described (Gerstmeier et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was measured at day 4 and day 6 using the Cell-Titer Glo assay (Promega). Viability data was analyzed by comparing the relative viability change between base editing with the uORF gRNA and the associated parental CDS gRNA ...
-
bioRxiv - Systems Biology 2024Quote: ... FuGene 6 (cat#: E2692) transfection reagent and sequencing grade modified trypsin (cat#: V5111) were purchased from Promega. Cas9 endonuclease was purchased from Integrated DNA Technologies ...
-
A CRISPR activation screen identifies FBXO22 as an E3 ligase supporting targeted protein degradationbioRxiv - Biochemistry 2023Quote: ... FuGene 6 (cat#: E2692) transfection reagent and sequencing grade modified trypsin (cat#: V5111) were purchased from Promega. Cas9 endonuclease was purchased from Integrated DNA Technologies.
-
bioRxiv - Biochemistry 2023Quote: ... 2-4μg bacmid was transfected into Sf9 cells in 6 well plates using Insect-XPRESS (Promega E2311). Cells were incubated at 2°C for 5 days and bacmid YFP expression assessed by Leica DM IL LED Fluo microscope using a green fluorescent protein filter cube ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length fragment of human PFKFB3-5 was amplified with primers PFKFB3-5 reverse and PFKFB3-5 forward and subcloned into the plasmid pGEM-T using the T/A Cloning Kit (Promega, Mannheim, Germany). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... A fragment of the rat Piezo 1 cDNA was amplified with Taq Polymerase and the oligonucleotide primers 5’-GAGGAAGAGGACTACCTT and 5’-TTTACTTAGAAAACCCTACAG from bladder total RNA and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Sequence was confirmed by Sanger capillary sequencing and sense and antisense RNA probes were synthesized with T7 and SP6 RNA polymerases (Roche-Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... The effect on cell viability of PTNP was assessed using the MTS [(3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium)] assay (CellTiter 96 cell proliferation assay kit; Promega, WI, USA) (92) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 μl of Master Mix (Promega, Madison, WI, USA), 3.94 μl of ddH2O ...
-
bioRxiv - Immunology 2019Quote: ... consisting of 5 X Green GoTaq Flexi Buffer (Promega), dNTP mix (0.2 mM per dNTP ...
-
bioRxiv - Immunology 2019Quote: ... 5% CO2 CellTiter 96 Aqueous One Solution (Promega, #G3582) was added to measure cell proliferation ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µL of 5X GoTaq Green Master Mix (Promega), 0.125 µL of 5u/µL GoTaq G2 polymerase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and serial dilutions of indicated human mAbs ...
-
bioRxiv - Systems Biology 2020Quote: 100 mM TEAB and 5 ug trypsin (Promega V5113)
-
bioRxiv - Neuroscience 2021Quote: ... + 5% RNAse inhibitor (40U/ul, Promega RNAsin inhibitor N2511). Samples were then transferred to a tube for processing by our Genome Technology Access Center (GTAC ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 5 μL of 5X RT buffer (Promega), 5 μL of dNTPs ...
-
bioRxiv - Cancer Biology 2021Quote: ... then digested with 5 ng / μl Trypsin Gold (Promega) in 9% Acetonitrile and 40 mM Ambic ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng of Renilla luciferase plasmid (Promega pRL-CMV), and 50 ng of Gal4-DNA binding domain-human RORγt-ligand-binding domain fusion protein plasmid per each well ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 µl of 5X Green GoTaq Buffer (Promega, M791A), 0.2 µl of GoTaq DNA polymerase (Promega ...