Labshake search
Citations for Promega :
501 - 550 of 4194 citations for 4 1 1 2 3 3 3 Hexafluoropropoxy acetophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Caspase 3/7 activity was measured using the Caspase-Glo assay kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Caspase 3/7 activity and cell viability were determined by ApoTox-Glo assay kit (G6321, Promega). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... the second set of plates was analyzed by adding CellTiter-Glo 2.0 Reagent (Promega, G9242/3) and measuring luminescence on a GloMax Discover System (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Tryptic digestion was performed for 3 h with 0.1 μg trypsin at 37°C (Promega, V5113) per sample ...
-
bioRxiv - Cell Biology 2024Quote: ... were measured 48hr post-transfection using the Proteasome-Glo 3-Substrate Cell-Based Assay System (Promega) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2024Quote: RNAs including 5’ and 3’ UTRs were synthesized in vitro using T7 RNA polymerase kit (Promega). cDNA from A ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2024Quote: Genomic fragment containing the murine Rorc 3’UTR was cloned into psiCHECK2 luciferase reporter plasmid (Promega). This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5 ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: ... The pellets from centrifugation at 1,500 g for 3 min were lysed in Reporter lysis buffer (Promega) containing 0.16 U µl−1 Ribosafe RNase inhibitors ...
-
bioRxiv - Bioengineering 2020Quote: ... Homozygous lpat2-3 T-DNA insertional mutants were identified by PCR using Promega PCR Master Mix (Promega) and combinations of the gene specific and T-DNA left border primers pairs ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 3’UTR fragments were cloned in the XbaI site of the pRL-CMV vector (Promega, #E2261) (pCMV-Luc-PTCH1 3’UTR wt/mut) ...
-
bioRxiv - Plant Biology 2020Quote: ... using 3 - 5 μg of total RNA and 250 ng of a mixture of random hexanucleotides (Promega) and incubated for 50 min at 50°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... The experiment was continued for 3 days and then the cells were treated with CellTiter-Blue (Promega) and incubated for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then incubated for 3 days and viability was assessed using CellTiter- Glo assay (Promega, G7572) following manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cell pellet (on ice) was resuspended in 3 ml Red Blood Cell Lysis Solution (Promega, Z3141) for 4 min and span down for 5 min at 300g in a pre-cooled centrifuge.
-
bioRxiv - Cancer Biology 2021Quote: ... samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... and then lung lobes were inflated with 3% (w/v) 45°C prewarmed low-melting agarose (Promega). The inflated lung lobes were immediately removed and cooled on ice for 15 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were subjected to Caspase 3/7 activity measurement with Caspase-Glo assay kit (Promega, Madison USA). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’UTR-Nogo-A-wt product was subcloned into both the pGEM-T-easy plasmid (Promega) and the pBKS plasmid (pBluescript ...
-
bioRxiv - Molecular Biology 2022Quote: ... the HIV 5’ LTR from the pNL4-3 isolate (Genbank AF324493) was cloned into pGL3-Basic (Promega) via Gibson assembly (NEB 2X HiFi ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nuclear pellets obtained after centrifugation at 1,500g for 3 min were lysed in Reporter lysis buffer (Promega), passed through a 21Gneedle and incubated on ice for 10 min before centrifugation at 17,000g ...
-
bioRxiv - Genetics 2020Quote: ... for 3 hours at 37°C in the presence of RNasin Ribonuclease Inhibitor (Promega #N2111, Madison, WI), and PE2 mRNA was purified with MEGAclear™ Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated for 6 h at 37°C with 3 μg Sequencing Grade Modified Trypsin (Promega). Digestion was terminated via addition of 20 μL trifluoroacetic acid (TFA) ...
-
bioRxiv - Cell Biology 2020Quote: ... bound proteins were alkylated and digested with endopeptidase Lys-C (Wako) for 3 hours and trypsin (Promega) on beads overnight at 37°C.
-
bioRxiv - Cancer Biology 2021Quote: ... cell viability and Caspase activity were detected with CellTiter-Glo 2.0 and CaspaseGlo-3/7 assay (Promega) respectively 2 days after transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... the full length of wnt4 including 3’-UTR was cloned into pGEM-T easy vector (Promega, A1360) by primers 5’-ATGTCATCGGAGTATTTGATAAGG-3’ and 5’-AGTCTTTGACACAGCATATATTTC-3’ from cDNA ...
-
bioRxiv - Immunology 2023Quote: ... VP1-3 proteins were then bound to the S-Trap column and digested with trypsin (Promega Corporation) for 2 hrs at 47°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Immunology 2023Quote: Proteasome activity was measured in cell lysates using the Proteasome-Glo™ 3 Substrate System (Promega, G8531). Corresponding reagents for testing as chymotrypsin-like ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were adjusted to 3 mM EDTA and digested with 1.0 μg Trypsin/LysC mix (Promega #V5073) for 1 h at 37 °C ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... Relative cell growth at day 3 was evaluated by CellTiter-Glo Luminescent Cell Viability Assay (Promega, #G7571). The concentration of inhibitor required for 50% inhibition of cell viability (IC50 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Cancer Biology 2024Quote: ... caspase activity in cells was measured using the commercially available Caspase-Glo 3/7 Assay (#G8090, Promega). Ultra-low attachment counts were normalized to the attached plate measured 16 h after seeding.
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 1.0 µg Trypsin/LysC mix (Promega #V5073) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 µg Trypsin/LysC mix (Promega #V5073) for 1h at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with PBS and lysed with 100 µL of 0.05% Triton X-100 (Promega). The contents of the well were serially diluted ...
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with PBS and lysed with 100 µL of 0.05% Triton X-100 (Promega). The contents of the well were serially diluted ...
-
bioRxiv - Microbiology 2024Quote: ... Concentrated protein extracts were then digested with 3 µl trypsin according to manufacturer’s instruction (Promega, Madison, WI, USA) at 37 °C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... the wild type and mutated Nnat 3’UTR was inserted into a pmirGLO dual-luciferase expression vector (Promega). Detailed description of the design of these constructs and of the rescue constructs are listed in the supplementary material section ...