Labshake search
Citations for Promega :
501 - 550 of 5242 citations for 3 4 Hydroxy 5 isopropyl 6 oxo 1 6 dihydro pyrimidin 2 ylsulfanyl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... were co-transfected with 0.5 μg of spike expression plasmids in pCDNA3 using Fugene 6 and following the manufacturer’s instructions (Promega). Cell-cell fusion was measured using an Incucyte and determined as the proportion of green area to total phase area ...
-
bioRxiv - Cell Biology 2020Quote: ... and the solution was added to OMEM (75 μL) containing 6 μL Fugene HD reagent (Promega, Madison, WI). The mixture was incubated at room temperature for 10 minutes and gently added to the growth medium on the cultured cells ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated for 24 h and viability was measured following a 6 h incubation with CellTiterBlue (Promega). Viability was quantified by fluorescent measurement (Ex ...
-
bioRxiv - Microbiology 2023Quote: Lentiviral particles were produced by transfection of HEK293T cells in T150 flasks using Fugene 6 transfection reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... DF1 cells were transfected with the different RCAS retroviral plasmids using FuGENE 6 Transfection reagent (Promega, Cat. E2691), accordingly to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 8 µg of pcDNA3.1-GFP-mNLS-K145Q using Fugene 6 Transfection reagent (Promega, E2692) per manufacturer protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was assessed 6 days post-treatment using a Cell-TiterGlo 3D Cell Viability assay (Promega, G9683), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were transfected with LDLR-GFP (WT, C75W, and C75W/C34W) for 48 h with Fugene 6 (Promega). Cells were starved in 5% LPDS media (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1mg of the plasmid was transfected to 293T cells (ATCC #CRL-11268) using FuGENE 6 Transfection Reagent (Promega) to produce the retroviruses ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with plasmid DNA by the calcium phosphate or lipofection method using FuGene 6 (Promega, WI) (Yoshida et al. ...
-
bioRxiv - Neuroscience 2023Quote: HEK293T cells were transfected with either Tau-encoding or control constructs using Fugene 6 (Promega, cat. no. E2691) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... methylase was amplified using M.SssI_HindIII forward and reverse primers (Sup Table 6) cloned into pGEMT-Easy (Promega, USA) and sequenced for verification ...
-
bioRxiv - Genetics 2024Quote: ... Effects on endogenous FAS exon 6 inclusion were determined by PCR using GoTaq flexi DNA polymerase (M7806, Promega) and the following primers:
-
bioRxiv - Molecular Biology 2024Quote: Cells were seeded in 12-well plates at a density of 200,000 per well and transfected using 1.5 µl/well FuGENE 6 (Promega) with 5 ng of CMV-Renilla plasmid (pTG888) ...
-
bioRxiv - Cell Biology 2024Quote: ... precipitated proteins were resuspended in 0.1% RapiGest with 6 μL of sequencing-grade trypsin (Promega, 0.5 μg/μL) added to each sample and digested overnight at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Immunology 2020Quote: Activity of the inflammatory caspases 1/4/5 was measured using a commercially available Caspase-Glo® 1 Inflammasome Assay (Promega, WI, USA) from HFFs seeded in 96-well plates (2×104 cells per well) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Apoptosis was assessed by incubating the cells with 200nM Staurosporin or medium for 4 h and the caspase 3/7 activity was assayed using the ApoOne Caspase 3/7 Assay (Promega). Senescence associated β-Galactosidase activity was analyzed with the Senescence Associated β-Galactosidase Staining Kit (Cell Signalling Technologies) ...
-
bioRxiv - Biochemistry 2022Quote: ... 3.5 mM MgCl2, and 2 mM ATP (for nucleic acid substrates containing RNA, 2 U/μl of RNasin Ribonuclease Inhibitor (Promega)) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... FuGene HD (Promega, E2311, 1:3).
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Immunology 2022Quote: Replication competent HIV were produced by transfection of HEK293T cells in T150 flasks using Fugene 6 transfection reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The cells were incubated for an additional 6 hours at 37°C before 75μl of Bio-Glo Luciferase Assay Reagent (Promega) was added to each well ...
-
bioRxiv - Molecular Biology 2021Quote: ... All the clones were transfected into the HEK-293T cells at 90% confluency using FuGene 6 as transfection reagent according to the manufacturer’s instructions (Promega). dsiRNAs targeting Rpp30 (10 nM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fresh bacmid DNA was transfected into Sf9 cells at 0.5×106 cells/mL in 6-well cell culture plates using FuGene HD (Promega) according to the manufacturer’s protocol (final concentration 10 μg/mL) ...
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were transfected with WT or mutant C10 constructs using the FuGENE 6 transfection reagent (Promega, cat# PRE2691). The cells were incubated at 37 C at least overnight before downstream analysis.
-
bioRxiv - Neuroscience 2020Quote: ... and 0.4 pmol/well of hairpin constructs (pscAAV-GFP-shFoxP1 or shCtrl) using FuGENE 6 Transfection Reagent (#E2691, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Vero E6 cells (1.2 x 106 cells/well, 6-well format) after 24 hpi using passive lysis buffer (Promega) based on the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Viral particles were packaged in HEK293T cells seeded at a density of 1.5×106/10cm petri dishes in a proportion of 24μL Fugene 6 (Promega, E2691) in 136μL serum-reduced OPTI-MEM (Gibco ...
-
bioRxiv - Microbiology 2020Quote: Env-pseudotyped luciferase reporter viruses were generated by co-transfection of 810 ng of an env expression vector and 810 ng of pZM247Fv2Δenv backbone (22) using 293T cells and the Fugene 6 reagent and protocol (Promega). Five hours after transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... The constructs (1.2 µg) were cotransfected with vesicular stomatitis virus G (600 ng) and pSPAX2 (800 ng) using FuGENE 6 (Promega). The lentiviral supernatants were collected 2 days after transfection ...
-
bioRxiv - Developmental Biology 2020Quote: ... C2C12 myoblasts were seeded at 20-30% confluence in 10cm format (CELLSTAR) and forward-transfection with Fugene-6 (Promega) according to manufacturer’s protocol with the following plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... fresh bacmid DNA was transfected into Sf9 cells at 0.5×106 cells/mL in 6-well cell culture plates using FuGene HD (Promega) according to the manufacturer’s protocol (final concentration 10 μg/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
Loss of intermicrovillar adhesion impairs basolateral junctional complexes in transporting epitheliabioRxiv - Cell Biology 2024Quote: A validated CDHR2 KO CL4 cell clonal population was transfected with pHALO-N3-CDHR2 using FuGENE 6 (Promega #E2691) at a FuGENE:DNA (μL:μg ...
-
bioRxiv - Microbiology 2023Quote: HFF or HEK293 cells (3 × 104 cells per well of a 24-well plate or 1 × 105 cells per well of a 6-well plate) were reverse transfected with 0.5 μg of pCW57-CMV-KDEL-mCherry-GF using Fugene HD (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Beads were washed 6 times with 50 mM ammonium bicarbonate and then treated with TPCK-treated modified trypsin (Promega) for 16 hours at 37°C on an end-over-end rotator ...
-
bioRxiv - Microbiology 2023Quote: ... 6 μg of IMC was transfected into 293T cells in a T25 flask using the FuGENE6 transfection reagent (Promega). The cells were cultured at 37°C for 6 hours before the medium was replaced by fresh medium ...
-
bioRxiv - Biochemistry 2022Quote: ... the D10ACas9 nickase and the HDR template on 6-well plates at 70% confluency using FuGene® HD (Promega). Cells were allowed to recover for 7-10 days (splitting if necessary ...
-
bioRxiv - Biochemistry 2022Quote: ... and penicillin (100 U/ml)/ streptomycin (100 μg/ml) (complete media) then transfected with Fugene 6 (Promega, Madison, WI). Cells were then lysed 2 days post-transfection using a lysis buffer containing 150 mM NaCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega, Cat #E2691). Media containing lentiviral particles were collected at 24 ...
-
bioRxiv - Cell Biology 2022Quote: ... pX459-derived plasmids encoding both Cas9 and the gRNA were transfected using Fugene 6 (cat. no. E2692 from Promega). 24 h post-transfection puromycin was used to select for transfected cells ...
-
bioRxiv - Cell Biology 2024Quote: ... they were transfected with either control plasmid or Flag-GSK-3α WT human plasmid using Fugene 6 (Promega, #E2693) at a 3:1 ratio (DNA:Fugene 6) ...
-
bioRxiv - Cell Biology 2024Quote: ... Transfection was performed in 6-cm dishes using 7.5 μg of linearized DNA and 15 μg of Fugene HD transfection reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Fresh bacmid DNA was transfected into Sf9 cells at 0.5×106 cells/mL in 6-well cell culture plates using FuGene HD (Promega) according to the manufacturer’s protocol (final concentration 10 µg/mL) ...
-
bioRxiv - Developmental Biology 2024Quote: Plasmids described above or in our previous work(13) were transfected into Neuro2a cells (ATCC) with Fugene 6 (Promega). The transfected cells were selected by puromycin and subjected to RNA extraction with Trizol (Sigma) ...
-
bioRxiv - Cell Biology 2024Quote: ... clarified by centrifugation (500 x g, 5 min, at 15°C) and mixed 1:1 with 2× passive lysis buffer (Promega cat #E1941). Cell monolayers were washed in PBS and lysed in 1× passive lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... beads were suspended in digestion buffer (Tris 50 mM pH 7.5, urea 2 M, 1 mM DTT and 5 µg.µl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...