Labshake search
Citations for Promega :
501 - 550 of 1776 citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µl/well of room temperature Caspase Glo 3/7 (Promega) reagent was added to the treated and control cells ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 µg plasmid was combined with 3 µl FuGENE (Promega, E2311) in OptiMEM medium for each ml of culture medium ...
-
bioRxiv - Cancer Biology 2024Quote: Caspase activity was measured using Caspase-Glo® 3/7 (Promega) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: Apoptosis was measured using the Caspase-Glo 3/7 Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... Sorted nuclei were collected in 5-ml tubes containing 300-500 μl of collection buffer (PBS + 5% BSA) and RNasin Plus RNase inhibitor (Promega). Sorted nuclei were collected by centrifuging at 500g for 10 min at 4°C and processed for downstream analyses (RNA-seq ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ng renilla control reporter vector (Promega), mock luciferase ...
-
bioRxiv - Genomics 2024Quote: ... lysed by a 5× reporter lysis buffer (Promega) and incubated overnight at −20°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Genomics 2020Quote: RNA was isolated via acid-phenol extraction.72 RNA was DNase treated with RQ1 DNase (Promega M6101) by addition of 5µL RQ1 buffer and 5µL RQ1 DNase to each RNA sample ...
-
bioRxiv - Plant Biology 2022Quote: Glutathione and Ascorbic acid content were quantified using the GSH-GLO Glutathione Assay Kit (Promega, Madison, USA) and Megazyme kit (K-ASCO 04/19 ...
-
bioRxiv - Microbiology 2020Quote: Genomic deoxyribonucleic acid (gDNA) was isolated from each mutant using the Wizard® gDNA purification kit (Promega). Illumina NextSeq was then performed by the Genomic Services Facility at Indiana University Center for Genomics and Bioinformatics ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was extracted using the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Cat# AS1330, Promega) or Maxwell® RSC miRNA from Plasma or Serum (Cat# AS1680 ...
-
bioRxiv - Cell Biology 2024Quote: ... One μg of mass spectrometry grade trypsin (Trypsin Gold, Promega; 1 mg/mL in 0.03% acetic acid) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... extracted from 5 HPVL and 5 LPVL (Table S3, Petersen et al., 2021) were treated with the DNase RQ1 (Promega, US). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... 1,3 μg of plasmid DNA and 3 μl of FuGene 6 (Promega) were mixed in 100 µl Opti-MEMTM medium before the addition to the dish ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was co-transfected with 3 ng phRG-TK Renilla vector (Promega) as normalization control ...
-
bioRxiv - Molecular Biology 2021Quote: ... transfected with 1 µg DNA and 3 µl FuGENE HD (Promega, E2311) in 150 µl Opti-MEM media according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5µg was analyzed using the Caspase 3/7 glo kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and caspase activity was measured by Caspase-Glo 3/7(Promega, G8092).
-
bioRxiv - Immunology 2021Quote: ... after added 100 mL of Caspase-Glo 3/7 reagent (Promega, USA), the plate was gently shaken at room temperature for 2 h and the luminescence was measured by a plate-reading luminometer.
-
bioRxiv - Cancer Biology 2020Quote: Apoptosis was measured using the Caspase-Glo® 3/7 Assay (Promega) based on the manufacturer’s instructions and our previous work (21 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cellular apoptosis was analyzed with Caspase-Glo 3/7 assay kits (Promega), which measures Caspase-3/7 activity ...
-
bioRxiv - Cell Biology 2020Quote: ... in 2× SSC supplemented with 3% (vol/vol) RNasin Ribonuclease inhibitor (Promega), 6% (vol/vol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 ng of the Renilla Luciferase expressing pRL-SV40 plasmid (Promega) for normalization ...
-
bioRxiv - Cell Biology 2021Quote: ... 3) TGFβ2 (2.5 ng/ml) + U0126 (10 μM; Promega, Madison, WI, USA), 4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Apoptosis of cells was determined using Caspase-Glo 3/7 Assay (Promega) according to the manufacturer’s recommendations.
-
bioRxiv - Neuroscience 2022Quote: ... and anti-activated Caspase 3 (rabbit, Promega, catalog #G7481, 1:250, RRID:AB_430875), and appropriate secondary antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... amplicons were ligated into the Renilla luciferase 3’UTR of psiCheck2 (Promega) vector linearized with Xho-I and Not-I ...
-
bioRxiv - Microbiology 2020Quote: Caspase 3/7 activity was measured by using Caspase Glo reagent (Promega). MDA-MB-231 and MDA-MB-436 cells were adsorbed with reovirus at an MOI of 500 PFU/cell for 1 h at room temperature or treated with 50 μM etoposide ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by 3 μL sequencing-grade trypsin solution (1 μg/μL, Promega), and the sample was incubated for 12 h at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Promega Caspase-Glo™ 3/7 Assay Kit was obtained from Promega Corporation (Madison ...
-
bioRxiv - Molecular Biology 2023Quote: ... by addition of 3 μl Renilla-Glo™ reagent (Promega, Cat# E2710) and measuring the luminescence signal with the ViewLux uHTS Microplate Imager (PerkinElmer ...