Labshake search
Citations for Promega :
451 - 500 of 5339 citations for ssc mir 411 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... the luciferase substrate was added for chemiluminescence detection (Promega; Luciferase Assay system ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μL of ONE-glo luciferase detection reagent (Promega) was dispensed per well and luminance signal recorded with an Envision plate reader (Perkin Elmer).
-
bioRxiv - Microbiology 2019Quote: ... cDNA was synthesized using M-MLV RT (H–) (Promega) and U3 antisense primer 5’-TGTGTGGTAGATCCACATCG-3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 µL reverse transcriptase (RT, Promega, Madison, Wisconsin, US) and RNase-free water were added ...
-
bioRxiv - Pathology 2022Quote: ... 200 units reverse transcriptase (M-MLV RT, M1701, Promega), 2mM dNTPs and 20 units RNAsin (N2615 ...
-
bioRxiv - Immunology 2020Quote: ... and M-MLV RT RNAse (H-) Point Mutant (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 5 μL of 5X RT buffer (Promega), 5 μL of dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... the GoTaq® 1-Step RT-qPCR System (Promega) was used with the primers (F ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were equilibrated to RT and CellTiter-Glo (Promega) solution (100μL ...
-
bioRxiv - Biochemistry 2021Quote: ... and GoTaq® 1-Step RT-qPCR System (Promega) were used for RT-qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... using M-MLV-RT and random hexamer primers (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Microbiology 2023Quote: ... using M-MLV-RT and random hexamer primers (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The identity of each cell line was confirmed by DNA fingerprinting via short tandem repeats at the time of mRNA and total protein lysate preparation using the PowerPlex 1.2 kit (Promega).
-
bioRxiv - Microbiology 2020Quote: ... and DNA-concentration was determined using a QuantiFluor® dsDNA kit (detection limit: 50 pg/mL; sensitivity: 0.01 – 200 ng/µL) and Glomax® –Multi+ system (Promega, Madison, WI) with the blue fluorescence optical kit installed (Ex ...
-
bioRxiv - Microbiology 2021Quote: qPCRs were performed with MLV SuMLV primers using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes against siRNA populations were PCR products labelled with the Prime-a-Gene kit (Promega). Over-night hybridization at 42°C was in PerfectHyb buffer (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... PCR-amplification of both nosZ genes used the Promega GoTaq qPCR kit (Promega, Madison, WI) and 1 μL of DNA template (25-50 ng genomic DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR2 products were cleaned up and concentrated by SV wizard PCR cleanup kit (Promega), Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplicons were purified using a Wizard SV Gel and PCR Clean up System kit (Promega) and EcoRI/XhoI digested pGREG533 was gel purified using a Qiaex II kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... The first PCR products were purified using a commercial purification kit (Promega, Madison, WI, USA), diluted ...
-
bioRxiv - Biochemistry 2023Quote: ... the linearized DNA was purified using the Wizard® SV Gel PCR purification kit (Promega). For the synthesis of 5’-capped mRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... the DNA was purified using the Wizard SV Gel and PCR Clean Up Kit (Promega). Immunoprecipitated DNA was analyzed by qPCR using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Pathology 2020Quote: ... cDNA synthesis from the mRNA was performed using a Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) kit (Promega, Madison, Wisconsin, USA) in a Mastercycler® Gradient (Eppendorf ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 μL of N2 primers and probe (2019-nCov CDC EUA Kit, Integrated DNA Technologies) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15min for reverse transcription ...
-
bioRxiv - Microbiology 2023Quote: ... the presence of other main circulating arboviruses was evaluated by RT-qPCR using GoTaq® 1-Step RT-qPCR System (Promega, Madison, WI, USA). Specific diagnosis primers were used for Zika [30] ...
-
bioRxiv - Bioengineering 2023Quote: ... an extended time-released substrate (Promega), and plates were incubated at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... and luminescence assessed with a Glomax Multi Detection System (Promega).
-
bioRxiv - Evolutionary Biology 2021Quote: ... on the GloMax Multi Detection system (Promega, Madison, WI, USA), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence was read on a Glomax Multi+ Detection System (Promega). CSV files were exported on a USB flash drive for analysis.
-
bioRxiv - Cell Biology 2021Quote: ... Luminescence was measured with the GloMax Multi Detection System (Promega).
-
bioRxiv - Cancer Biology 2020Quote: ... Luminescence was measured on the GloMax-multi detection system (Promega). For the colony formation assays ...
-
bioRxiv - Cancer Biology 2021Quote: ... and proteins were visualized with a chemiluminescence detection system (Promega). Band intensities were quantified using AlphaView Software and results are expressed relative to the control condition ...
-
bioRxiv - Microbiology 2021Quote: ... reading luminescence on a GloMax ®-Multi Detection System (Promega). For each condition ...
-
bioRxiv - Genetics 2020Quote: ... Plates were read using a GloMax Multi-Detection System (Promega).
-
bioRxiv - Genomics 2022Quote: ... Luminescence was detected using a GloMax-Multi Detection System (Promega).
-
bioRxiv - Plant Biology 2022Quote: ... Fluorescence was measured with the GloMax-Multi+ Detection System (Promega).
-
bioRxiv - Cancer Biology 2024Quote: ... and bioluminescence was detected by GLOMA MULTI detection system (Promega).
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription (RT) was performed with AMV reverse transcriptase (Promega) in final volume 20 μl for 1h at 42°C on 1 μg of total RNA in the presence of two reverse primers (1 μl of 5 μM solution each ...
-
bioRxiv - Microbiology 2020Quote: ... and then cDNA was produced using M-MLV RT (Promega) and random hexamers ...
-
bioRxiv - Neuroscience 2022Quote: ... using GoTaq® Probe 1-Step RT-qPCR System (Promega). The CDC SARS-CoV-2 nucleoprotein N2 primer set was used for amplification ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using GoTaq qPCR Master Mix (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 μL of reverse transcriptase (M-MLV RT, Promega) and incubated the samples for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... using the GoTaq 1-Step RT-qPCR System (Promega, USA) and primers targeting the gene coding for the endogenous control β-actin ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR was performed using GoTaq qPCR Master mix (Promega). Cycling conditions were as follows ...
-
bioRxiv - Immunology 2020Quote: ... using the MMLV-RT reverse transcriptase enzyme (Promega, Madison WI) to obtain the complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 mM dNTP) and 1 μl of AMV RT (Promega) was added and the sample was incubated at 42 °C for 1 hour ...
-
bioRxiv - Physiology 2020Quote: ... Reverse transcription (RT) was performed with AMV-reverse transcriptase (Promega). Quantitative PCR (qPCR ...