Labshake search
Citations for Promega :
451 - 500 of 5642 citations for ssc mir 376a 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer’s protocol and directly sequenced using 10F primer to identify individual bacteria isolates at the genus level ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes from PCR products were radiolabeled using the Prime-a-Gene kit (#U1100, Promega) in the presence of [α-32P]-dCTP (Hartmann Analytic ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse transcription-PCR was performed using a cDNA synthesis kit (Promega, Madison, WI, USA) and 2 μg of total RNA according to the manufacturer's protocol ...
-
bioRxiv - Developmental Biology 2019Quote: PCR amplification was performed using GoTaq G2 Hot Start Green Master Mix kit (Promega) in a 25 µL standard reaction mix and the following program ...
-
bioRxiv - Molecular Biology 2020Quote: ... All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega. All PCR products were examined using the QIAxcel® capillary electrophoresis system 100 (Qiagen).
-
bioRxiv - Genomics 2022Quote: ... products were gel purified using the Wizard SV Gel and PCR Cleanup kit (Promega) and ligated into pDONR221-b1b4 (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... amplicons were purified with a WizardTM PCR Clean Up kit (Promega, Fitchburg, WI, USA). PCR products were sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: The toxicity of PX was investigated on monolayers of BLEC seeded on 96 well plates or on inserts luminal side in co-culture experiments using the commercially available Cytotoxicity Detection Kit (Promega, United States). An aliquot of 25 μl medium was taken to quantify the lactate dehydrogenase (LDH ...
-
bioRxiv - Cell Biology 2021Quote: TdT-mediated dUTP nick-end labeling (TUNEL) or EdU assays were performed by using in situ cell death detection kit (TUNEL, Promega Corporation, G3250) or EdU Click-iT® Assay Kit obtained from Thermo Fisher (C10639) ...
-
bioRxiv - Physiology 2020Quote: ... The transferase dUTP Nick End Labeling (TUNEL) assay was performed on cryosections of rat eyes using the TUNEL apoptosis detection kit (DeadEnd Fluorometric TUNEL System; Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: The ATP quantification was performed using ENLITEN® ATP Assay System Bioluminiscence Detection Kit from Promega (protocol by (Yang et al., 2015)) ...
-
bioRxiv - Immunology 2023Quote: DNA in the HHMX-stimulated supernatants of THP1 dual reporter cells was quantified using the QuantiFluor dsDNA Detection Kit from Promega (catalog # E2670) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... of SNHG16 sequence and the 3’-untranslated region (UTR) fragment of STARD9 containing miR-1301-3p binding site were subcloned into the pmirGLO vectors (Promega, Madison, WI, USA) to generate SNHG16-Wt/Mut vectors and STARD9-Wt/Mut vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1-3μl aliquots were taken for reverse transcription (RT) using the Moloney murine leukemia virus RT RNase H (−) (Promega, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: The quantification of viral RNA was carried out in one-step RT-qPCR using 3 µl of the eluted RNA with the GoTaq® Probe One-step RT-qPCR System (Promega, Poland). This procedure employed in-house primers and a probe specifically tailored for the HCoV-229E N sequence ...
-
bioRxiv - Microbiology 2020Quote: ... using a GloMAX®-Multi Detection system (Promega, UK). 50 µL reagent added at a speed of 200 µl/s followed by mixing and 2 s delay ...
-
bioRxiv - Microbiology 2022Quote: ... and read on a GloMax multi-detection system (Promega).
-
bioRxiv - Bioengineering 2021Quote: ... for radiography detection or with untagged Methionine (Promega #L118A) and Green Lysine (FluoroTect™ GreenLys ...
-
Core Microbiota Drive the Prevalence of Extracellular Antibiotic Resistome in the Water CompartmentsbioRxiv - Microbiology 2022Quote: ... Detection and quantification using QuantiFluor ™ -ST (Promega, USA). The raw eDNA samples and PCR products were checked by agarose gel electrophoresis (Fig ...
-
bioRxiv - Neuroscience 2019Quote: ... ADP detection system (ADP-Glo) was purchased from Promega. Inhibitors were synthesized as described by Boyd et al [18] ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 100 μl ROS-Glo detection reagent (Promega, Southampton, UK) was added per well ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50ul of NAD/NADH-Glo™ Detection Reagent (Promega) was added to each well ...
-
bioRxiv - Plant Biology 2023Quote: ... and quantified with a GloMax-Multi Detection System (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... the Nano-Glo HiBiT Lytic Detection Assay (N3040, Promega) was performed according to the manufacturer’s guidelines ...
-
bioRxiv - Bioengineering 2023Quote: ... and the GloMax®-Multi Detection luminometer System (Promega). The experiments were carried out in three biological replicates for the Z-Cre vs ZZ-Cre ZIKV replicase comparison experiment and once for the ZZ-Cre NIEV ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase substrate was added for chemiluminescence detection (Promega; Luciferase Assay system ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μL of ONE-glo luciferase detection reagent (Promega) was dispensed per well and luminance signal recorded with an Envision plate reader (Perkin Elmer).
-
bioRxiv - Immunology 2024Quote: ... Plates were read on GloMax Multi Detection System (Promega) at wavelengths of 480 nm and 520 nm for excitation and emission ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was synthesized using M-MLV RT (H–) (Promega) and U3 antisense primer 5’-TGTGTGGTAGATCCACATCG-3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 µL reverse transcriptase (RT, Promega, Madison, Wisconsin, US) and RNase-free water were added ...
-
bioRxiv - Pathology 2022Quote: ... 200 units reverse transcriptase (M-MLV RT, M1701, Promega), 2mM dNTPs and 20 units RNAsin (N2615 ...
-
bioRxiv - Immunology 2020Quote: ... and M-MLV RT RNAse (H-) Point Mutant (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 5 μL of 5X RT buffer (Promega), 5 μL of dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... the GoTaq® 1-Step RT-qPCR System (Promega) was used with the primers (F ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were equilibrated to RT and CellTiter-Glo (Promega) solution (100μL ...
-
bioRxiv - Biochemistry 2021Quote: ... and GoTaq® 1-Step RT-qPCR System (Promega) were used for RT-qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... using M-MLV-RT and random hexamer primers (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using M-MLV-RT and random hexamer primers (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Cancer Biology 2024Quote: ... The identity of each cell line was confirmed by DNA fingerprinting via short tandem repeats at the time of mRNA and total protein lysate preparation using the PowerPlex 1.2 kit (Promega).
-
bioRxiv - Microbiology 2020Quote: ... and DNA-concentration was determined using a QuantiFluor® dsDNA kit (detection limit: 50 pg/mL; sensitivity: 0.01 – 200 ng/µL) and Glomax® –Multi+ system (Promega, Madison, WI) with the blue fluorescence optical kit installed (Ex ...
-
bioRxiv - Microbiology 2021Quote: qPCRs were performed with MLV SuMLV primers using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes against siRNA populations were PCR products labelled with the Prime-a-Gene kit (Promega). Over-night hybridization at 42°C was in PerfectHyb buffer (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... PCR-amplification of both nosZ genes used the Promega GoTaq qPCR kit (Promega, Madison, WI) and 1 μL of DNA template (25-50 ng genomic DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR2 products were cleaned up and concentrated by SV wizard PCR cleanup kit (Promega), Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplicons were purified using a Wizard SV Gel and PCR Clean up System kit (Promega) and EcoRI/XhoI digested pGREG533 was gel purified using a Qiaex II kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... The first PCR products were purified using a commercial purification kit (Promega, Madison, WI, USA), diluted ...
-
bioRxiv - Cancer Biology 2024Quote: ... the DNA was purified using the Wizard SV Gel and PCR Clean Up Kit (Promega). Immunoprecipitated DNA was analyzed by qPCR using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... the linearized DNA was purified using the Wizard® SV Gel PCR purification kit (Promega). For the synthesis of 5’-capped mRNA ...