Labshake search
Citations for Promega :
451 - 500 of 627 citations for Recombinant Human Interleukin 7 Receptor Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Caspase 3/7 activity in primary neuronal cells was measured using ApoTox-Glo Triplex Assay kit (Promega, Madison, WI, USA) as per the manufacture’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... the whole lane was cut in 7 bands and digested, as described (Shevchenko et al, 1996) with sequencing-grade trypsin (Promega). For the ubiquitination analysis ...
-
bioRxiv - Microbiology 2020Quote: Apoptosis induction by T3DC and inhibition by Z-VAD-FMK was determined using the Caspase-Glo 3/7 Assay System (Promega). PC3 cells were plated at 1 × 104 cells per 96 well plate and 24 h later were either treated with docetaxel ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Pro-apoptotic caspase 3/7 activation was measured in worms harvested from mice following drug treatment using the Caspase-Glo 3/7 Assay Kit (Promega). Worms were harvested from either the mesenteries or liver of mice ...
-
bioRxiv - Cell Biology 2020Quote: Measurements of caspase activities in cells were performed using the commercially available Caspase-Glo 3/7 Assay (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... cell viability followed by caspase 3/7 activity were measured using CellTiter-Fluor™ Cell Viability Assay kit (Promega, G6080) and Caspase-Glo® 3/7 Assay System (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... The sample was diluted 1:7 with 0.1 M NH4HCO3 before overnight digestion of proteins with trypsin (Promega, cat#V5113) at 30°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... the MCF-7 and MDA-MB-231 cells were infected with Plasmids expressing RFP or GFP using Fugene 6 (Promega) at an early passage and were selected using 2 μg/ml puromycin (Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... Cell number was measured after 3 and 7 days and normalized to the initial reading at day 0 using the CellTiter Glo Luminescent Cell Viability Assay (Promega). The experiments shown represent fold change at day 7 relative to day 0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MCF-7/CA-IX cell lines by standard clonogenic stable cell construction procedures using Fugene HD (Promega, E 2311). The U2-OS and HEK-293 cells transfected with empty pCMV6 (PS10001 ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... using Lipofectamine 2000 and assays were performed 48 hours later using the Apo-ONE Homogeneous Caspase-3/7 Assay (Promega). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... DNA used for microarray was isolated from frozen cell pellets (3×106-7×106 cells) using the Maxwell RSC Cultured Cells DNA Kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... serum stimulation was done with DMEM containing 15 % FBS and cells were harvested after 7 h of stimulation and SRF reporter activity was measured with Dual-Luciferase reporter assay system (E1910; Promega) and a luminometer ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Neuroscience 2020Quote: ... after which beads were washed with 1X High Salt Wash Buffer(50mM Tris-HCl pH 7.4, 350mM NaCl, 1%NP-40 and 1 unit/ul Promega recombinant RNAsin). In the last wash ...
-
bioRxiv - Biochemistry 2021Quote: ... RRL were incubated for 5 min at 30°C then 10 min on ice with buffer containing 1U/μl of recombinant RNasin (Promega®), 75 mM KCl 0.5 mM MgCl2 ...
-
bioRxiv - Biophysics 2023Quote: ... The initial recombinant baculovirus was generated by transfecting adherent Sf9 cells with the bacmid DNA using the FuGENE HD reagent (Promega, USA) and used to infect suspension cells for virus amplification ...
-
bioRxiv - Developmental Biology 2024Quote: ... The katna1 digoxigenin-labelled sense and antisense riboprobes were synthetized from the linearised recombinant TOPO® TA cloning vector using T7 and T3 RNA Polymerase (Promega) according to the supplier’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... albicans as well as of a commercially available human protein digest (Promega), which was exclusively used in this experiment ...
-
bioRxiv - Biochemistry 2023Quote: MS-Compatible Human Protein Extract Digest (K562) was purchased from Promega (V6951), MassPREP E ...
-
bioRxiv - Cell Biology 2023Quote: ... human BLTP2/KIAA0100 ORF was amplified from pFN21A-Halo-KIAA0100 (FHC00016, Promega). An unstructured linker (sequence ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The recombinant plasmid was digested with Sac1 and Nde1 restriction enzyme and sub-cloned in pGL3 Basic luciferase vector (Promega, Madison, USA).
-
bioRxiv - Biochemistry 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (MMLV-RT) enzyme and recombinant RNasin® ribonuclease inhibitor were purchased from Promega (Madison, WI, USA). Evagreen 2X qPCR MasterMix was purchased from Applied Biological Materials Inc ...
-
bioRxiv - Genomics 2022Quote: ... The primers were commercially synthesized (IDT) and tested on human genomic DNA (Promega) to confirm generation of only one amplicon product at the expected size ...
-
bioRxiv - Genetics 2020Quote: ... Deidentified healthy donor DNA was obtained from Promega (Human Genomic DNA: Female, G152A). DNA from ALS cases (ND11836 and ND13803 ...
-
bioRxiv - Cancer Biology 2020Quote: 2000bp human lncRNA-TANAR(ENST00000425110.1) promoter was cloned into PGL3 basic vectors (Promega). By mutating the crucial site of AR binding site in the lncRNA-TANAR 5’ promoter to EcoRI cutting site (-GAATTC) ...
-
bioRxiv - Immunology 2022Quote: Human LRBA was cloned in seven different fragments into pCIneo FLAG vectors (Promega). These plasmids were kindly provided by Dr ...
-
bioRxiv - Genomics 2022Quote: ... diluted to 1% in purified human genomic DNA (Promega, female, catalog No. G1521). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: A whole-cell protein extract from human K562-cells (Promega, V6941, lot 444583) was dissolved in 50 mmol/L Tris and 6.5 mol/L urea ...
-
bioRxiv - Biochemistry 2021Quote: ... Pull down assays were performed utilizing myc-tagged proteins that were generated from recombinant pGBKT7-derivatives through in vitro transcription/translation using wheat germ extract (cat# L4330, Promega, Madison, WI, USA)(Stephan et al. ...
-
bioRxiv - Microbiology 2023Quote: ... As a qPCR standard the recombinant plasmid pBELX-1 (Bellanger et al., 2014) was extracted using the Wizard plus SV Miniprep DNA Purification System (Promega, Madison, WI, USA) according to the manufacturers’ instructions and linearized by restriction enzyme BamHI (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...