Labshake search
Citations for Promega :
451 - 500 of 1153 citations for Recombinant Human Interleukin 2 Receptor Alpha Fc chimera since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... or pB.2-eIF2α-S51A plasmids by use of FuGENE6 (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... Each reaction was treated with 2 units of RQ1 DNase (Promega) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μl of Trypsin/Lys-C mix (0.5μg/μl, Promega, V5073) was added to each sample and incubated for 3 hrs at RT in the dark ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were digested by addition of 2 % (w/w) trypsin (Promega) over night at 37°C after adding 50 mM ammonium hydrogen carbonate to a final concentration of 1 M urea ...
-
bioRxiv - Plant Biology 2020Quote: ... from 2 μg RNA treated with RQ1 RNase-free DNase (Promega). The cDNA was then diluted 20 times in water and 5 μl of the dilution was used for the realtime qPCR analysis ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were additionally diluted 2-fold and digested with trypsin (Promega, Sequencing Grade Modified Trypsin ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg Lys-C/Trypsin mix protease (Promega, Mass spec grade) were added to each sample (10 mM EPPS pH 8.5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RdRP products were treated with RNase I (2 U, Promega) at 37°C for 2 hours to digest single-stranded RNAs completely ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 2× GoTaq q-PCR master mix (Promega, USA) and 0.6 μM of AF77/78 or AF79/80 primer pairs targeting a region close to the Cori or to the terminus (ter) ...
-
bioRxiv - Genetics 2020Quote: ... 2 μg RNA were treated with RQ1 RNase-free DNase (Promega) followed by reverse transcription using M-MLV Reverse Transcriptase (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μg of MS grade Trypsin Platinum (Promega, Madison, WI, USA) in 40 μL of digestion buffer containing 50 mM TEAB was added into the filter and digested at 37°C for 16 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nano-Glo Luciferase Assay Substrate furimazine (2 µl ml-1, Promega) was added and the nLuc released upon proteolytic cleavage of the receptor was measured on a plate reader Mithras LB 940 (Berthold Technologies ...
-
bioRxiv - Physiology 2023Quote: ... The assay medium was supplemented with 2% GloSensor Reagent (Promega #E1291) and 0.1% BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μM 11S and 2 μl furimazine solution (Promega Cat. # N1610) were added and the luminescence read at 1 min intervals for 10 min using the FLUOstar Omega using a gain value of 3,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids (2 μg /dish) were transfected using FuGENE6 transfection reagent (Promega), according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... Any remaining RNA was removed with 2 µl RNase A (Promega) added to a pool of DNA samples ...
-
bioRxiv - Physiology 2024Quote: The 2-DG glucose uptake for tissues was analyzed by Promega Glucose uptake-Glo assay method (#J1341) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the GoTaq 2-step RT-qPCR system (Promega, Madison, MA, USA) was utilized to perform cDNA synthesis and qPCR ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μL/well of One-Glo detection reagent (Promega, cat # E6120) was added to all microplate wells via Multidrop ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µl of RNAse A solution (4 mg ml-1) (Promega) were added before incubation at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Crosslinks were reversed by addition of 2 uL Proteinase K (Promega) and incubation at 65 °C for 12-16 hours in a Thermomixer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10X Primer extension buffer and 2 U AMV Reverse Transcriptase (Promega) were added to the annealing mixture and incubated for 1 hour at 42 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 ng of Renilla luciferase expressing pRL SV40 plasmid (E2231, Promega), as internal control ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...