Labshake search
Citations for Promega :
451 - 500 of 616 citations for Recombinant Human Apolipoprotein A I Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Purified RNA was further subject to a DNase treatment using the RQ DNase I (Promega, Madison, WI, USA) following the manufacturer protocol with small modifications ...
-
bioRxiv - Genomics 2022Quote: ... The primers were commercially synthesized (IDT) and tested on human genomic DNA (Promega) to confirm generation of only one amplicon product at the expected size ...
-
bioRxiv - Genetics 2020Quote: ... Deidentified healthy donor DNA was obtained from Promega (Human Genomic DNA: Female, G152A). DNA from ALS cases (ND11836 and ND13803 ...
-
bioRxiv - Cancer Biology 2020Quote: 2000bp human lncRNA-TANAR(ENST00000425110.1) promoter was cloned into PGL3 basic vectors (Promega). By mutating the crucial site of AR binding site in the lncRNA-TANAR 5’ promoter to EcoRI cutting site (-GAATTC) ...
-
bioRxiv - Immunology 2022Quote: Human LRBA was cloned in seven different fragments into pCIneo FLAG vectors (Promega). These plasmids were kindly provided by Dr ...
-
bioRxiv - Genomics 2022Quote: ... diluted to 1% in purified human genomic DNA (Promega, female, catalog No. G1521). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: A whole-cell protein extract from human K562-cells (Promega, V6941, lot 444583) was dissolved in 50 mmol/L Tris and 6.5 mol/L urea ...
-
bioRxiv - Biochemistry 2021Quote: ... Pull down assays were performed utilizing myc-tagged proteins that were generated from recombinant pGBKT7-derivatives through in vitro transcription/translation using wheat germ extract (cat# L4330, Promega, Madison, WI, USA)(Stephan et al. ...
-
bioRxiv - Microbiology 2023Quote: ... As a qPCR standard the recombinant plasmid pBELX-1 (Bellanger et al., 2014) was extracted using the Wizard plus SV Miniprep DNA Purification System (Promega, Madison, WI, USA) according to the manufacturers’ instructions and linearized by restriction enzyme BamHI (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were incubated at either 15°C or 37°C for 10 min in Buffer I containing 0.4 U/µL of RNasin (Promega). Following renaturation ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplified products were visualized with reference to DNA ladders (either: Hyperladder I, Bioline, London, UK, or 1kb ladder, Promega), using GeneSnap (Syngene ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were trypsinised on the beads in 60 μl of Buffer I (2 M urea, 50 mM Tris-HCl pH 7.5, 5 μg/ml Trypsin [modified sequencing-grade trypsin; Promega]) for 30 min at 37°C in a thermomixer ...
-
bioRxiv - Zoology 2020Quote: ... 0.2 μl of Acetylated BSA at 10 μg/μl and 0.5 μl of 10 U/μl restriction enzyme Alu I (Promega), 12.3 μl of DNase-free water and 5 μl of PCR products ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was used for first-strand cDNA synthesis with the Reverse Transcription System I (Promega, Madison, WI, USA), then diluted 1:50 in water ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 10,000 x g and 4°C for 2 min and digested by addition of RNAse-free DNAse I (Promega) for 10 min on ice ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Probe synthesis reactions were performed at 37 °C for 3 h and then were treated with DNase I (Promega) at 37 °C for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and human 293T cells as producer cells using the FUGENE HD transfection reagent (Promega), as described [50] ...
-
bioRxiv - Pathology 2019Quote: ... human primary aortic SMCs were transfected with pGL4.34 Vector plasmids (E1350; Promega, Madison, WI) using Effectene Transfection Reagent (301425 ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... we used a 1/1500 artificial mix of promastigote DNA and human DNA (Promega) to reflect the median ratio found in clinical samples ...
-
bioRxiv - Neuroscience 2022Quote: Open reading frames of human OR genes were subcloned into pCI (Promega, WI, USA) with a Rho-tag (the sequence encoding the first 20 amino acids of rhodopsin ...
-
bioRxiv - Immunology 2023Quote: ... tailed with complete TRAC and TRBC1 gene segments amplified from human genomic DNA (Promega), respectively ...
-
bioRxiv - Biochemistry 2024Quote: ... 24 hours after transient transfection with mouse or human ENPP3 via Fugene 6 (Promega), the media was gently removed and replaced with serum-free DMEM supplemented with 1% insulin-transferrin-selenium-sodium pyruvate (ThermoFisher ...
-
bioRxiv - Biochemistry 2021Quote: ... Genomic DNA was eliminated by incubating 10 μL of isolated RNA with 1 U of RQ1 RNase-free DNase I (Promega) for 30 min at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Genomic DNA was eliminated by incubating 2 μg of RNA with 2 U of RQ1 RNase-free DNase I (Promega) for 30 min at 30°C ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNAs from 15 wild type and 15 mutant zebrafish embryos were extracted using TRI reagent (MRC) and treated with RQ1-RNase free DNase I (Promega) and Proteinase K (Sigma ...
-
bioRxiv - Genetics 2022Quote: Chromatin accessibility by real-time PCR (ChART-PCR) was performed as previously described (75) using 20 U DNase I (Promega). To assess nucleosome occupancy ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 ug (for cellular RNA) and 20 ng (for EV RNA) was treated with 1 U of DNAse I RNAse-free (#EN0521 PROMEGA) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... One aliquot was stored at −80°C for later infectivity analyses and the other aliquot was treated with DNAse I (RQ1 DNAse, Promega) prior to purification of viral DNA using a PureLink Viral RNA/DNA minikit (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by a DNase I treatment and a subsequent reverse transcription with oligo d[T]18 using the GoScript RT kit (Promega). One-step RT-qPCR was performed using the SYBR FAST Mix optimized for LightCycler 480 (KAPA ...
-
bioRxiv - Genetics 2020Quote: ... Colorimetric Cell Viability Kit I (WST-8 reagent, PromoKine, Heidelberg, Germany) and Caspase-Glo® 8 Assay (Promega, Madison, WI) were used for cell viability assay and caspase-8 assay ...
-
bioRxiv - Molecular Biology 2022Quote: ... U2OS reporter cell lines were simultaneously co-transfected with siRNA using Dharmafect1 (Dharmacon) and DNA (RFP and I-Sce1 endonuclease expression constructs) using FuGene6 (Promega), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... REBOV Vp40- pGEM-T Easy and MERS-CoV UpE-pGEM-T Easy were first linearized by Sal I enzyme (Promega) creating a 5’overhang ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... the total RNA was incubated with DNase I to remove the trace amount of DNA (Promega Company, Madison. Wisconsin. USA) for two hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of total RNA was incubated with RNase-free DNase I (1 unit/μl) following the protocol provided by the manufacturer (Promega), followed by reverse-transcription into first-strand cDNA using ImProm II reverse transcriptase (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Trace amounts of contaminating genomic DNA were removed by treating all RNA samples with RNAse-free DNase I prior to use for cDNA synthesis according to the manufacturer’s instructions (Promega, WI).
-
bioRxiv - Plant Biology 2020Quote: ... The recombinant Halo-His-gene was expressed using a 30 μL TNT®SP6 High-Yield Wheat Germ Protein Expression System (Promega, USA, Catalog No L3261). Expression levels were determined by SDS-PAGE and western blot ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentiviral packaging vectors into human HEK-293T cells via calciumphosphate transfection (Promega; Madison, WI, USA), according to manufacturer’s directions ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of human PAQR3 was cloned into pmirGLO vector (Promega, Madison, WI, USA), and then validated by sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human SMARCB1 was translated in vitro using TNT Quick Coupled Transcription/Translation System (L1170, Promega). 1 µg of pcDNA3.1-FLAG-SMARCB1 was incubated at 30°C for 90 minutes with 20 µM methionine and TNT T7 Quick Master Mix ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cell lines were DNA fingerprinted for provenance using the Power-Plex 1.2 kit (Promega) and confirmed to be the same as the DNA fingerprint library maintained by ATCC ...
-
bioRxiv - Bioengineering 2021Quote: The open reading frame for human SOX17 was PCR amplified using GoTaq Master Mix (Promega) from the PB-TRE3G-SOX17 plasmid (Table S5) ...
-
bioRxiv - Genetics 2022Quote: ... human POPDC1 and POPDC2 cDNA sequences were cloned into the pFC14K or pFC32K plasmids (Promega), which contain C-terminus sequences for HaloTag and NanoLuc tags ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA of the eggs was extracted and treated with DNase I using the ReliaPrep RNA Tissue Miniprep System (Promega, USA). Total RNA of the primary queens or kings was separately extracted from the body (except for the head parts ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μg of total RNA was incubated with 1mM of Oligo-AP primer (Supplementary Table I) and Improm II reverse transcriptase (Promega®) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5% sodium deoxycholate (protect from light), 1:200 Protease Inhibitor Cocktail III), and then, incubated with RNase I (Life Technology, AM2295) and DNase (Promega, M6101) in a Thermomixer at 1200 rpm to fragment RNA at 37 °C for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mL aliquots of phage lysate with a titer of approximately 109 PFU mL-1 was digested with DNase I (Thermo, CA, USA) and RNase A (Promega, USA) to remove any residual bacterial genomic DNA and RNA according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... To reduce the viscosity of the lysate and remove contaminating DNA the lysate was incubated with RQ1 DNase I (10U/ml Promega, M6101) for 30 minutes on ice ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Genomics 2024Quote: ... 1x SYBR Green I] and calculated from a standard dilution series of a PCR product (quantified with QuantiFluor® dsDNA System, Promega with a DeNovix DS-11 spectrometer ...