Labshake search
Citations for Promega :
451 - 500 of 6299 citations for Osteopontin Human OPN ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Cancer Biology 2020Quote: Relative viability was determined in 96 well plates using the CellTiter-Blue Cell Viability Assay (Promega), including a minimum of triplicate wells per sample ...
-
bioRxiv - Cancer Biology 2019Quote: ... Remaining plate with cells was used to perform CellTiter-Glo® Luminescent Cell Viability Assay (Promega) to normalize ROS data to number of viable cells ...
-
bioRxiv - Immunology 2019Quote: ... the plates were assayed using the CytoTox-ONE Homogenous Membrane Integrity Assay (#G7890, Promega, Madison, WI) as per the kit protocol ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: Three wells of a 6-well plate were lysed were lysed in Reporter lysis buffer (Promega) for 10 min on ice before centrifugation at 17,000 g ...
-
bioRxiv - Cancer Biology 2020Quote: ... plates were assayed for cell viability using the CellTiter Blue (CTB) Viability Assay (Promega, Madison, WI) as previously described (47).
-
bioRxiv - Bioengineering 2022Quote: ... To each well of the 96-well plate containing supernatant was added CytoTox 96 Reagent (Promega). The plate was shielded from light and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 96 well plates of putative positive clones were labelled with 500 nM Halo-TMR dye (Promega) for 15 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 24h after transfection luciferase levels determined using Promega dual luciferase assay and GloMax plate reader (Promega).
-
bioRxiv - Neuroscience 2020Quote: ... For transfection experiment cells were plated in 24 well plates and transfected with FuGene HD (Promega).
-
bioRxiv - Cell Biology 2019Quote: ... Cells were seeded in poly-D-lysine coated plates and transfected with FuGENE® HD (Promega) the following day according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... Relative light units (RLU) were measured using a Promega GLOMAX plate reader (Promega, Madison, WI, USA) and values were reported as fold increase over the RLU measured in co-culture of HeLa cells transfected an empty vector (V ...
-
bioRxiv - Genetics 2020Quote: ... Dual luciferase activity was measured in 96-well plates using a GloMax Navigator microplate luminometer (Promega). Four biological replicates were used for each experimental condition ...
-
bioRxiv - Cancer Biology 2022Quote: ... plate was equilibrated at room temperature for 30 mins and 100 μl CellTitre Glo 3D (Promega) cell viability assay reagent was added to 100 μl of cells in the well with vigorous shaking for 5 mins ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were measured once per day for 8 days in a GloMax 96 Microplate Luminometer (Promega). For luminescence ...
-
bioRxiv - Microbiology 2022Quote: Adult parasites picked into PBS in 96-well plates were stained with CellTox (Promega, Madison, WI) using the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... the second set of plates was analyzed by adding CellTiter-Glo 2.0 Reagent (Promega, G9242/3) and measuring luminescence on a GloMax Discover System (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells in the 96-well plate were analyzed by Dual-Glo Luciferase Assay Systems (E2920, Promega). Firefly luciferase (F-Luc ...
-
bioRxiv - Microbiology 2022Quote: ... Single cycle monolayers were seeded in white bottom plates and read directly for NLuc activity (Promega) on a Synergy HT plate reader (BioTek) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Luminescence was measured in raw luminescent units (RLU) using a GloMax® multimodal plate reader (Promega). Reads across a time course were performed using separate wells.
-
bioRxiv - Microbiology 2023Quote: ... Luciferase activity was measured using a Glomax plate reader using the Renilla Luciferase Assay System (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Absorbances were read using the Dual-Nano-Glo protocol with a GloMax plate reader (Promega #GM3000) in flat-bottom ...
-
bioRxiv - Genomics 2023Quote: ... BrdU incorporation was detected by measuring absorbance at 450 nm using a GloMax plate reader (Promega).
-
bioRxiv - Physiology 2023Quote: HEK293T cells were cultured in 12-well plates and transfected with polyethylenimine or FuGENE 4K (Promega). LRRC10-Cer and Holo-CaV1.2 venus (Ven)-tagged cDNA pairs (20 ng and 2 μg ...
-
bioRxiv - Biochemistry 2023Quote: The initial HaloTag-based APMS (HaloMS) was performed using a commercially available HaloTag ligand plate (Promega, HaloLink 96 Well Plate ...
-
bioRxiv - Systems Biology 2024Quote: ... After 48 hours each plate was treated with 25 mL’s of CellTiter Glo (Promega Corp G7572) and read in enhanced luminescence mode on an EnVision Multi-Label plate reader (Revvity Corp.) ...
-
bioRxiv - Microbiology 2024Quote: ... The luminescence was measured in a 384 well plate using NanoGlo® live cell buffer (Promega) supplemented with 1:50 of either a membrane impermeable substrate (Promega) ...
-
bioRxiv - Neuroscience 2024Quote: ... The plate was incubated for 40 min at RT before reading luminescence using GloMax Explorer (Promega) plate reader ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were washed once with PBS and lysed in passive lysis buffer on the plate (Promega). For mitotic cells ...
-
bioRxiv - Cell Biology 2024Quote: ... in a 96-well-plate using a blue filter of the GloMax Discover Microplate Reader (Promega). Obtained values were corrected by subtracting background fluorescence value (i.e. ...
-
bioRxiv - Biochemistry 2024Quote: ... plates were equilibrated to RT for 15 min and CellTiter Glo reagent (Promega, Madison, WI, USA) was added followed by orbital shaking for 2 min ...
-
bioRxiv - Cell Biology 2020Quote: ... caspase8 Kit (Promega company); Caspase3 / 7 Kit (Promega company).
-
bioRxiv - Molecular Biology 2020Quote: ... or Maxwell kit (Promega). Following RNA extraction ...
-
bioRxiv - Genetics 2023Quote: ... the GoScript Kit (Promega) was used to make cDNA and qRT-PCR performed on a BioRAD c1000 Touch thermocycler.
-
bioRxiv - Molecular Biology 2019Quote: ... a total of 1□μg of RNA for each sample was reverse-transcribed to cDNA using reverse-transcription kits (Promega, Madison, WI, USA), and real-time quantitative reverse transcription (qRT)-PCR was performed on a 7500 real-time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 μL of N2 primers and probe (2019-nCov CDC EUA Kit, Integrated DNA Technologies) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15min for reverse transcription ...
-
bioRxiv - Genomics 2023Quote: ... The resulting DNA was resuspended in 1× IDTE buffer (Integrated DNA Technologies, Coralville, IA, USA) and quantified using the QuantiFluor One dsDNA kit (Promega, Madison, WI, USA). The HiFi reads were obtained using the SMRT Cell 8M and the PacBio Sequel II instrument ...
-
bioRxiv - Microbiology 2024Quote: ... Six presumptive transconjugant colonies were randomly selected and grown overnight in 1 mL of LB prior to DNA extraction using the Wizard® Genomic DNA Purification kit (Promega, Madison, WI). The AMR genotypes of transconjugant colonies were determined by polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were co-transfected with pcDNA5/FRT construct encoding haemagglutinin (HA)-tagged human CB1 receptor cDNA and pOG44 (Flp recombinase plasmid) using transfection reagent Fugene HD (Promega) as previously described for AtT-20 pituitary tumour cells [26] ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...