Labshake search
Citations for Promega :
451 - 500 of 648 citations for Irisin Human Mouse Rat HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... As secondary antibody an anti-mouse IgG HRP conjugate (Promega, Madison, WI, USA) was used ...
-
bioRxiv - Molecular Biology 2021Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:4000 Promega, Fitchburg, USA) was used as secondary antibody ...
-
bioRxiv - Microbiology 2019Quote: ... Secondary antibodies (anti-mouse or anti-rabbit) conjugated to horseradish peroxidase (HRP, Promega) were diluted 1:25,000 in 3% (w/v ...
-
bioRxiv - Immunology 2020Quote: ... 1:3,000 dilution of HRP-conjugated anti-mouse IgG secondary antibody (W402B, Promega) was added and incubated for one additional hour ...
-
bioRxiv - Microbiology 2019Quote: ... containing 3ng of mouse GAPDH RNA (in-vitro transcribed using T7 RiboMAX (Promega), as per manufacturer’s protocol) ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the full-length mouse HCN2 was cloned in pCI (Promega) mammalian expression vector ...
-
bioRxiv - Developmental Biology 2020Quote: ... The primary antibodies that were used are mouse β-Gal (1:250; Promega), mouse anti-Cora C615.16 (1:400 ...
-
bioRxiv - Cell Biology 2021Quote: ... and then anti-mouse IgG (H&L) alkaline phosphatase-conjugated secondary antibodies (Promega) were incubated with the blots at a dilution of 1:5,000 for 1 h at room temperature (RT) ...
-
bioRxiv - Immunology 2022Quote: ... Anti-Rabbit (W4018) and Anti-Mouse (W4028) secondaries antibodies were bought from Promega.
-
bioRxiv - Microbiology 2022Quote: ... Secondary anti-mouse IgG HRP antibody was used at 1:7000 dilution (Promega). ChemiDoc (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... from Invitrogen and HRP-conjugated anti-mouse (W4021) and anti-rabbit (W4011) antibodies from Promega.
-
bioRxiv - Cell Biology 2023Quote: ... anti-mouse IgG (H+L) HRP-conjugated (1:10000; Cat. no. W4021, Promega), and anti-rat IgG (H+L ...
-
bioRxiv - Neuroscience 2023Quote: ... or a 1:100 dilution of mouse anti-βIII Tubulin (Cat # G7121, Promega) antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... The following antibodies were used for immuohistochemistry: mouse anti-β-gal (Z3781, Promega), chicken anti-NeuN (266006 ...
-
bioRxiv - Developmental Biology 2023Quote: ... We used the following primary antibodies: mouse anti-LacZ (1:500 dilution, Promega) rabbit polyclonal anti-cleaved Caspase 3 (1:200 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each mouse was injected intraperitoneally with 100mg/kg luciferin potassium salt (Promega, France). After mice were anesthetized ...
-
bioRxiv - Cell Biology 2020Quote: ... and SERBP1 were amplified from human cDNA and cloned into the appropriate vectors (pACT or pBIND) provided by the CheckMate Mammalian Two-Hybrid kit (Promega E2440). The appropriate combination of edited pACT and pBIND vectors ...
-
bioRxiv - Genomics 2020Quote: ... standard curves were generated by preparing 10 fold dilution series of plasmid DNA containing parasite 18SrRNA gene54 and from human genomic DNA (Cat No. G304, Promega, Australia). Thermal cycling was performed on a Light Cycler 480 II (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... or human IFN-β (1000 U/ml) and firefly luciferase activity was determined using the dual luciferase reporter assay system (Promega) on Cytation 3 (BioTek ...
-
bioRxiv - Immunology 2022Quote: The constant regions of the human TCR genes were replaced with murine constant genes by overlapping PCRs as previously described,14 and the human/murine hybrid TCR genes were sub-cloned into the pGEM-4Z vector (Promega Corporation) for mRNA expression ...
-
bioRxiv - Immunology 2022Quote: ... pneumoniae D39 or the isogenic mutants towards human epithelial cells was accessed using a CellTiter-Blue® (CTB) Cell Viability Assay (Promega), according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were blocked with PBS containing 5% skim milk and incubated with HRP-conjugated anti-human IgG1 antibodies (Promega, #W403B) overnight at 4 °C.
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was isolated from the 102 human FFPE colorectal tissue samples using the Maxwell® RSC Blood DNA Kit (Promega) on a Maxwell® 16 MDx (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... We used the following primary antibodies: mouse anti-β-galactosidase (Promega, 1:1,000 dilution), rabbit anti-GFP (MBL,1:1,000 dilution) ...
-
bioRxiv - Immunology 2021Quote: ... mouse tail DNA was amplified using GoTaq G2 Green Master Mix (Promega, cat. M7823) or KAPA Taq PCR Kit (Takara Bio ...
-
bioRxiv - Cell Biology 2020Quote: ... The peroxidase-conjugated secondary antibodies were goat anti-mouse IgG (715-035-151, Promega) and anti-rabbit IgG (711-035-152 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit IgG (Promega; 1:10,000) was incubated for 1 h at room temperature and then washed four times with PBS-Tween for 20 min ...
-
bioRxiv - Plant Biology 2019Quote: ... The secondary antibody was an anti-mouse coupled to HRP 1:10,000 (W4021, Promega). Detection was performed with the Pico Plus system (34580 ...
-
bioRxiv - Cell Biology 2019Quote: ... As secondary antibody a mouse IgG HRP conjugate was used (Promega, Madison, WI, USA). Detection was carried out by using AceGlow (VWR Peqlab ...
-
bioRxiv - Cancer Biology 2020Quote: ... membranes were probed with either goat anti-mouse IgG-HRP (Promega, catalogue no. W4021) or goat anti-rabbit IgG-HRP (catalogue no ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP conjugated anti-rabbit (W401B) and anti-mouse (W402B) secondary antibodies were from Promega. CB-5083 was a gift from Cleave Biosciences and Bortezomib was from Selleckchem ...
-
bioRxiv - Microbiology 2021Quote: ... Anti-mouse and anti-rabbit HRP-conjugated secondary antibodies were purchased from Promega (USA). Alexa Fluor 488 and Alexa Fluor 594 antibodies were purchased from Invitrogen (USA) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-mouse (W4028) and anti-rabbit (W4018) HPR-conjugated secondary antibodies were from Promega. Anti-Mouse Alexa Fluor 488 (A32790) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-mouse (W4028) and anti-rabbit (W4018) HRP conjugated secondary antibodies were from Promega. Anti-mouse Alexa® Fluor 488 (#A32790 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibodies were detected with an anti-mouse secondary antibody conjugated to HRP (Promega) at 1:5000 dilution in 5% fat-free milk ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 200 ng purified recombinant mouse DLX2 protein in Gel Shift Binding Buffer (Promega). Unlabeled probe was added for ‘cold’ competition ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Dad13 constructs were detected with using mouse-anti-β-galactosidase (1:1000, Promega) and rabbit-anti-β-galactosidase (1:1000 ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: Anti-mouse and anti-rabbit Abs conjugated with horseradish peroxidase (HRP) were from Promega Biotec (Madison ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA (0.5 µg) was reverse transcribed with mouse myeloblastosis virus reverse transcriptase (Promega) under standard conditions using hexanucleotide random primers according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:3,000 Promega, Fitchburg, United States) was used as secondary antibody ...
-
bioRxiv - Genetics 2023Quote: RNA was isolated from mouse liver using a Maxwell 16 LEV simplyRNA kit (Promega). For the American vs standard diet comparison strand-specific mRNA libraries were generated using the TruSeq Stranded mRNA protocol (Illumina ...
-
bioRxiv - Biochemistry 2022Quote: ... but the secondary antibodies were goat anti-mouse HRP conjugated antibody (Promega Cat #W4021) and goat anti-rabbit HRP conjugated antibody (Promega Cat # W4011) ...
-
bioRxiv - Developmental Biology 2023Quote: ... on embryos/larvae using mouse anti-β-gal (Promega catalog number Z3781, 1:1000) and rabbit anti-mCherry (BioVision ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit and mouse anti-β-Gal (MP Biomedics #559761 and Promega #Z378A, 1:1000), rabbit and mouse anti-pH3 (Merck Millipore #06-570 and Cell signal technology #9796 ...
-
bioRxiv - Immunology 2024Quote: The mouse Il12b promoter (−355 to +55) was cloned into the pGL4.10 vector (Promega). Motif mutations were introduced using the GENEART site-directed mutagenesis system (Invitrogen) ...