Labshake search
Citations for Promega :
451 - 500 of 725 citations for IL 5 Rat CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2023Quote: ... After incubation at 37 °C/5 % CO2 for 20 h 40 nl HaloTag® NanoBRET™ 618 Ligand (PROMEGA) was added to the cells using an Echo acoustic dispenser (Labcyte ...
-
bioRxiv - Immunology 2023Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... DNA from My-La cells was amplified by use of primers GATA3_AICE_KpnI s 5’-GCGGTACCATACAGACCCTTCCAGCCAC and GATA3_AICE_XhoI as 5’-GCCTCGAGAACAGATGTGGGGAGTCAGA and cloned via KpnI and XhoI into the multiple cloning site (MCS) of pGL3 (Promega). All constructs were verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were further diluted with 50 mM Tris pH 7.9 pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Immunology 2023Quote: Promoter constructs were created by cloning the immediate 4.5-kb region adjacent to the 5’ TSS of SPINK7 into the promoterless Nano-luciferase reporter vector pNL1.1-NL (Promega). The 4.5-kb sequence and subsequent constructs were created by using primers with the restriction enzyme sites KpnI-HF and XhoI ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) inner salt (Promega) was added to each well and the plate was further incubated for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were diluted using one volume of dilution buffer (10 mM Tris pH 8, 0.4% NP40, 5 mM CaCl2, 2 U/mL RQ1 DNAse (Promega)) and then incubated with anti-Flag or anti-p400 antibodies coupled to agarose beads (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... plates were washed 5 times with wash buffer (PBS with 1% BSA (Capricorn Scientific) and 0.05% Tween-20 (Promega)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 μL of [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (MTS) (Promega, #G3582) were added and incubated at 37°C for 3 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... beads were reconstituted in 5 μL 50 mM HEPES pH 8.0 buffer containing trypsin/rLys-C enzyme mix (Promega) at a 1:25 enzyme to protein ratio ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 µL of the supernatant were diluted in 45 µL of Luciferase Assay Reagent (Luciferase Assay System, E1500, Promega) and measured at a Synergy HT reader (BioTek ...
-
bioRxiv - Molecular Biology 2024Quote: ... 400 μl cold cell lysis buffer (20 mM HEPES, pH 7.4, 100 mM KCl, 5 mM, MgCl2, 500U/ml RNasin-Plus (Promega), 1x protease inhibitor cocktail (200X ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Neuroscience 2024Quote: ... 1–5 µl of gDNA was mixed with 0.5 µl of 10 mM dNTP mix (Promega, C1141, Madison, WI), 10 µl of 25 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... a multiplexed caspase/viability assay was performed as described before [5] using the Multiplex Assay ApoLive-Glo (Promega, G6411) kit.
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay Virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system (RNA1 qPCR primers GW194 and GW195)23.
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and further incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were digested overnight at 37 °C with 5 μL of trypsin (1 μg dissolved in 50 mM HEPES pH 8.0, Promega V5111). The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001) ...
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:5000 in 5% milk in TBST were used for detection by the addition of an enhanced chemiluminescence (ECL) substrate (Promega). Western blot quantification was performed using Fiji software (Schindelin et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 μg of each protein was then boiled in PCR tubes at 100 °C for 5 min and allowed to cool to room temperature before 1 μg mass spectrometry-grade trypsin (Trypsin Gold from Promega) was added to each sample ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Neuroscience 2021Quote: IP and pull-down probes of DG NSCs were subjected to on-bead digestion (Hubner et al., 2010) by trypsin (5 µg/ml, Promega) in 1.6 M Urea / 0.1 M Ammonium bicarbonate buffer at 27 C for 30 minutes ...
-
bioRxiv - Genomics 2020Quote: ... 500 cells were plated in each well of 96-well-plate and each sample had 6 replicates and monitored for 6 days from day 0 to day 5 by CellTiter-Glo 2.0 Assay (Promega, G9242) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 40% confluent HAP 1 WT cells (seeded in a 10-cm dish) were co-transfected with the two plasmids described above (5 µg each) using 30 µl Fugene6 transfection reagent (Promega) in OptiMEM medium ...
-
bioRxiv - Bioengineering 2020Quote: The therapeutic effect of free taxane (pro)drugs and LNP formulations was determined by the [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega) or the resazurin-based PrestoBlue assay (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% CO2) with a final DMSO concentration of 0.3% and assayed for viability using the CellTiter-Glo Reagent (Promega Corporation) as described in manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The genes of interest along with ∼700 bp of 3’ and 5’ flanking DNA were amplified and cloned into the vector pGEM-T Easy (Promega) to create pGEMlpg0277 ...
-
bioRxiv - Immunology 2019Quote: ... Expression of RLuc fusion proteins was estimated by measuring the luminescence of the cells after incubation with 5 µM coelenterazine H (Promega). In parallel ...
-
bioRxiv - Biochemistry 2019Quote: ... The washed beads were resuspended in 200 µl of digestion buffer and incubated for 5 h with 1 µg of trypsin (Promega) at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 150 ng trypsin (Trypsin Gold, Promega) at room temperature for 90 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 pmols of folded pre-tRNA substrate was incubated with a final concentration of 5 U ml−1 RNasin plus inhibitor (Promega), 5 mM ATP and 8 pmols of TSEN complex in a final reaction volume of 20 μl for 1 h at 30 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... Ligations of the digested plasmid backbones and PCR products occurred for 5-10 minutes at RT using T4 DNA ligase (Promega) prior to transformation into NEB® Turbo Competent E ...
-
bioRxiv - Biochemistry 2021Quote: The samples were reduced and digested in 25 μL co-IP digest buffer (50 mM Tris-HCl, 5 ng/μL trypsin (sequencing grade, modified, Promega), 2 M urea ...
-
bioRxiv - Cancer Biology 2020Quote: ... the blot was blocked with either 5% nonfat-milk or 5% BSA in TBST before addition of primary antibodies and followed with peroxidase-conjugated secondary antibody (Promega). Protein bands were detected using SuperSignal Chemiluminescent Substrate (Pierce ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 and 6 d using a CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (G3582; Promega, Madison, WI). Cells were incubated with the MTS reagent 3-4 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and were then incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... Halo fusion proteins were produced from 1.5 µg plasmid DNA in a 15 µL reaction using TNT SP6 High-Yield Wheat Germ Protein Expression System (Promega). Protein expression was confirmed by Western blot with Anti-HaloTag monoclonal Ab (1:2000 ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were sonicated for 30 seconds before centrifugation and 5 μl of the supernatants were collected for luciferase expression reading by the dual-luciferase reporter assay system (Promega) using a GLOMAX 20/20 luminometer (Promega) ...
-
bioRxiv - Immunology 2021Quote: ... cells13 for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR mixture was at a volume of 10 μL containing 5 μL SYBR Premix Ex Taq (Promega, Madison, USA), 0.5 μM each of the primers ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... Cross-links of input and IP material were reversed by adding 10 μl 5 M NaCl and 4 μl 10 mg ml−1 Proteinase K (Promega), and incubated for 4 hours at 65°C ...
-
bioRxiv - Cell Biology 2021Quote: ... the antibody–bead mixture was resuspended in 500 μl of the reaction mixture containing 10 μg of fragmented total RNA,100 μl of reaction buffer and 5 μl of RNasin Plus RNase Inhibitor (Promega), and incubated for at least 4 h at 4 °C ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM EGTA, 5% glycerol) and freshly supplemented reagents (1 mM DTT, 1 mM ATP, 1 mM PMSF, protease inhibitor mix (Promega) and 1% Tween 20) ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were digested to peptides by addition of 25 μl of 50 mM ammonium bicarbonate containing 5 μg of trypsin (Promega) and incubating (37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The remaining iodoacetamide was quenched by adding 5 mM DTT and the proteins were digested with 150 ng trypsin (Trypsin Gold, Promega) for 90 min at room temperature in the dark ...