Labshake search
Citations for Promega :
451 - 500 of 6757 citations for Cow Fructose 1 6 Bisphosphatase 2 FBP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Transfections were performed by complexing plasmids with FuGENE® 6 Transfection Reagent (Promega) in OptiMEM media (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmid transfections were performed in MDA-T32 cell line using Fugene 6 (Promega). Transfected cells were cultured for over 3 weeks in complete RPMI-1640 medium containing G418 (600 μg/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25,000 HEK293-T cells were seeded and transfected with FuGENE 6 (#E231A, Promega) and plasmid DNA at the carrier (µL):DNA (µg ...
-
bioRxiv - Molecular Biology 2024Quote: ... Trypsin digestion was performed at a concentration of 6 ng/μl (Promega, #V511A). Post-digestion ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Retrovirus was produced through transfection of HEK293 cells using FuGENE 6 (Promega, E2692). Two days after transfection ...
-
bioRxiv - Cancer Biology 2024Quote: HEK-293T cells were transfected using the FuGENE® 6 Transfection Reagent (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was run on 2% agarose gel and the expected bands were eluted using Wizard® SV Gel and PCR cleanup kit (Promega, USA),cloned in pGEM-T easy vector (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Filters were transferred to 2 mL microfuge tubes for further processing using the Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corporation) with a modified version of the kit protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cell viability was assessed by the viability assays 3-(4,5-dimetiltiazol-2-il)-5-(3-carboximetoxifenil)-2-(4-sulfofenil)-2H-tetrazolio (MTS) using the Cell-Titer 96c AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were extracted from a 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) and quantified by QuantiFluor™-ST (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mg/mL 50 μL aliquots of cleared lysates were incubated with 2 μL of indicated trypsin concentration (Promega) at 4°C for 15 min ...
-
bioRxiv - Microbiology 2021Quote: ... A partial trypsin digestion was performed to release proteins from the beads by using 80 μL of 2 M urea/50 mM Tris containing 1 mM DTT and 0.4 μg trypsin (Mass Spectrometry Grade, Promega) for 1 h at 25 C ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1 mini tablet of Complete EDTA-free protease inhibitor and 2 µl RNAse inhibitor (RNAsin Plus RNase Inhibitor, Promega). RNA was extracted using the RNASpin Mini kit (GE Healthcare ...
-
Blunted Fas signaling favors RIPK1-driven neutrophil necroptosis in critically ill COVID-19 patientsbioRxiv - Immunology 2021Quote: Supernatants were incubated 1:2 with the substrate solution of the CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega) for 30 min in the dark in a 96-well plate (Greiner) ...
-
bioRxiv - Biochemistry 2020Quote: ... before being washed and resuspended in 2 M urea and trypsinized overnight with 0.5 μg μl−1 sequencing grade trypsin (Promega). Tryptic peptides were eluted off ...
-
bioRxiv - Molecular Biology 2022Quote: ... Semiquantitative PCR reactions were carried out with 1–2 μL of cDNA and 0.2 μL of GoTaq DNA Polymerase (Promega) in a total reaction volume of 30 μL according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... to a final urea concentration of 2 M for overnight Trypsin/Lys-C digestion at 35°C (1:100 protease:substrate ratio, Mass Spectrometry grade, Promega Corporation ...
-
bioRxiv - Neuroscience 2022Quote: ... HEK cells were transfected with the targeting plasmid and two helper plasmids (psPAX2 and pMD2.G) at a 2:1.5:1 molar ratio using ProFection (Promega). Two to three days later ...
-
bioRxiv - Cell Biology 2022Quote: ... The gel pieces were rehydrated in trypsin solution (50 mM ABC pH 8.0, 1 or 2 µg trypsin per sample for proteome or BioID respectively, Promega) overnight at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Then the beads were incubated with 80 μL of 2 M urea in 50 mM Tris-HCL containing 1 mM DTT and 0.4 μg trypsin (Promega) at 25 °C for 1 hour while shaking at 1,000 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... Beads were resuspended in 500 µL of 100 mM Tris-HCl pH 8.0 containing 2 mM CaCl2 and digested at 37 °C for 1 h with 0.2 μg of trypsin/LysC (#V5073 Promega). The samples were then loaded onto homemade SepPak C18 Tips packed by stacking three AttractSPE disk (#SPE-Disks-Bio-C18–100.47.20 ...
-
bioRxiv - Cell Biology 2023Quote: ... various concentrations of the compounds were mixed with 1 - 2 nM sensor and 1,000-fold diluted furimazine (Nano-Glo Luciferase Assay Substrate, Promega) in 100 μL of buffer (50 mM HEPES ...
-
bioRxiv - Immunology 2023Quote: Transient transfection was performed using 1 or 2 µg plasmid DNA and 3.5 or 7 µl FuGENE HD transfection reagent (Promega) per 5x 105 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfection was performed in the 6-well culture plate using FuGene-HD (Promega, E2311) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Retrovirus was produced in Phoenix Amphotropic cells by transfection with FUGENE 6 (Promega E2692) of pLPC-TRF2 or pLPC-Empty ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were collected at day 6 and measured by CellTiter-Glo (Promega #PR-G7573) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: HEK 293T cells grown on 10 cm dish were transfected using FuGENE 6 (Promega) with the transfer vector pxPAX2 (Addgene #12260 ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were transiently transfected with 0.4 µg DNA using FuGENE 6 transfection reagent (Promega) in a 1:3 µg DNA:µL FuGENE ratio 48 h before electrophysiology measurements were performed.
-
bioRxiv - Immunology 2020Quote: ... China) or the D614G variant (constructed by site-directed mutagenesis) using FuGENE 6 (Promega). The next day ...
-
bioRxiv - Developmental Biology 2020Quote: ... For the immunolabeling experiment HeLa cells were transfected with plasmids using FuGENE 6 (Promega). For streptavidin pull-down assays from HEK293T cells ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid transfection of U2OS cells was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... Transfection with plasmid was performed following standard protocols for Fu gene 6 (Promega, #E2691). Cells were selected for stable expression using Geneticin (G418 sulfate ...
-
bioRxiv - Biophysics 2021Quote: ... U2OS cells transfection with engineered lentiCRISPRv2 were done using FuGENE 6 transfection reagent (Promega). Positive clones were selected using puromycin and subsequently isolated.
-
bioRxiv - Cell Biology 2022Quote: ... Bacmids were transfected to Sf9 insect cells by lipofection (FuGENE 6 Transfection Reagent, Promega), to generate baculovirus ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid transfection of U2OS cells was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with MX2-mScarlet vector using FuGENE 6 transfection reagent (#E2691, Promega) following the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plates were collected at day 6 and measured by CellTiter-Glo (Promega #PR-G7573). Cell viability values were analyzed following blank cell deductions and normalization to vehicle readings ...
-
bioRxiv - Biochemistry 2024Quote: ... 24 hours after transient transfection with mouse or human ENPP3 via Fugene 6 (Promega), the media was gently removed and replaced with serum-free DMEM supplemented with 1% insulin-transferrin-selenium-sodium pyruvate (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with TPMT-FLAG or TPMT A80P-FLAG with FuGENE 6 (Promega). 24 h post transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng/μl of mRNA and 6 ng/μl QuantiLum Recombinant Luciferase protein (Promega) were coinjected ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μg cellular RNA was treated with DNase (RQ1 Rnase-Free DNase kit Promega) and reverse-transcribed following the GoScript ™ Reverse Transcriptase Kit (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... and the 200 nM GoTaq® Probe 1-Step RT-qPCR System Kit (Promega). This kit uses GoTaq Probe qPCR Master Mix with dUTP (10 uL) ...
-
bioRxiv - Systems Biology 2024Quote: ... coagulans DSM 1 = ATCC 7050 was extracted using Wizard Genomic DNA Purification Kit (Promega) according to the protocol ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115), 8 pmol of DNA from step 1 and 10 µL T7 HiScribe enzyme ...