Labshake search
Citations for Promega :
451 - 500 of 1215 citations for Caspase 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Rabbit reticulocyte lysates (RRL, Promega) were used to investigate the inhibition of translation by DPR proteins ...
-
bioRxiv - Microbiology 2022Quote: ... and Nluc (rabbit Pab, Promega). Then ...
-
bioRxiv - Microbiology 2020Quote: ... and Nluc (rabbit PAb; Promega). A MAb against actin (MAb AC-15 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (G5601, Promega), guinea pig anti-Ctip 2 (325005 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and rabbit reticulocyte extract (Promega). All reactions were performed according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: ... The recombinant plasmids were isolated from the positive clones using the Pure Yield Plasmid Miniprep System (A1222, Promega, USA), and some potential positive plasmids containing the cDNA insert were digested with EcoRI and HindIII to confirm the presence of the IFNε cDNA insert.
-
bioRxiv - Immunology 2022Quote: ... Alkylation was carried out with 10 mM chloroacetamide at room temperature before adding recombinant sequencing-grade trypsin (0.1 μg, Promega). Digestion took place at 37º C for 18 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 3 nM of either XeARPP19 or various forms of ClyARPP19 (stock solutions at 1 μg/μL) were incubated in the presence of 62.5 units of recombinant bovine PKA (Promega) and 1 mM γS-ATP in a final volume of 30 μL of PKA Buffer (20 mM HEPES pH 7.4 ...
-
bioRxiv - Plant Biology 2024Quote: ... and the recombinant protein was produced using a TNT SP6 Coupled Wheat Germ Extract System (Promega, Madison, WI, USA). Magne Halo Tag Beads (Promega ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... CellTiter 96 AQueous One Non-Radiactive Cell Proliferation Assay based on 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) was from Promega (Duebendorf, Switzerland). COmplete™ EDTA-free protease inhibitor cocktail was obtained from Roche Diagnostics (Mannheim ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (#G3582; Promega, Madison, WI) was added and incubated at 37°C for 45 mins ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit and rat primary antibodies were detected with horseradish peroxidase (HRP) conjugated anti-rabbit (Promega) and anti-rat (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2022Quote: ... In-vitro translations were done with rabbit reticulocyte lysate (Flexi Rabbit Reticulocyte Lysate System, Promega) and translated CFTR (domains ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Cell Biology 2023Quote: Promega’s Capsase-Glo 3/7 Assay kit (G8093, Promega) was used to measure caspase activity according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h and with trypsin (1:25, Promega) for 16 h both at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-m6A conjugated beads were incubated with purified mRNA with rotation at 4°C overnight in 300 µL MeRIP buffer with 1 µL RNase inhibitor (recombinant RNasin; Promega). 10% of the mRNA sample was saved as the input fraction ...
-
bioRxiv - Molecular Biology 2019Quote: ... The recombinant plasmids were prepared from some positive clones using the PureYield Plasmid Miniprep System (Cat #A1222, Promega, Madison, USA). The sequencing of the cloned insert was carried out according to Sanger et al ...
-
bioRxiv - Biochemistry 2019Quote: The 5’UTRs of each transcript variant were transcribed and purified in vitro as previously described46 from linearized recombinant psiCHECK2 vector (Promega) that contained one of the three UTR sequences downstream of a T7 promoter ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were dissolved in 50 μL of 50mM TEAB and treated with 1 μL of recombinant PNGaseF (Promega, Madison, WI) overnight at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: RNA was isolated from pooled neurons that were stored at −80 in saline solution with 1% (v/v) Recombinant RNasin Ribonuclease Inhibitor (Promega). The RNA was extracted with the Quick-RNA micro prep kit (Zymo ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... The N-glycans were then released using 10 U recombinant Elizabethkingia miricola N-glycosidase F (Promega, V4831, 10 U/μL) for 16 h at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: CHO K-1 cells overexpressing hPD-L1 and the recombinant TCR ligand (hPD-L1 Antigen Presenting Cells, hPD-L1 aAPCs, Promega) and Jurkat T cells overexpressing hPD-1 and carrying a luciferase reporter gene under the control of Nuclear Factor of Activated T-cells Response Element (NFAT-RE ...
-
bioRxiv - Immunology 2020Quote: ... anti-m6 A conjugated beads were incubated with purified mRNA with rotation at 4C overnight in 300 mL MeRIP buffer with 1 mL RNase inhibitor (recombinant RNasin; Promega). 10% of the mRNA sample was saved as the input fraction ...
-
bioRxiv - Cell Biology 2022Quote: ... 60,000 nuclei were sorted using an SH800 sorter (Sony) into 50 μl of collection buffer [1.0U/μL Recombinant RNAsin (Promega, PAN2515), 5% Fatty-acid-free BSA in PBS (Proliant ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 ng of either XeARPP19 or ClyARPP19 were incubated with 200 μM ATP and 25 units of recombinant bovine PKA (Promega) in PKA Buffer for 3 hours at 37°C under 1200 RPM stirring ...
-
bioRxiv - Biochemistry 2023Quote: ... then alkylated (100 mM iodoacetamide in 100 mM ammonium bicarbonate at room temperature for 45 minutes) prior to in-gel trypsin digestion (30 μL of 6 ng/μL recombinant sequencing-grade trypsin (Promega) in 100 mM ammonium bicarbonate per cubed band ...
-
bioRxiv - Microbiology 2023Quote: 1 ml of recombinant GST or GST-YgfB protein at a concentration of 10 μM was incubated with 100 μl 50 % MagneGST (Promega) bead-slurry equilibrated with pulldown-buffer for 45 min at 4°C and washed two times with 500 μl pulldown-buffer ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Cancer Biology 2023Quote: ... recombinant methylated BCAR3 (see methylation assay method) was sliced from the gel and digested with modified trypsin (sequencing grade, Promega). The resulting peptides were analyzed by online nano liquid chromatography (LC)-MS/MS (UltiMate 3000 RSLCnano and Q-Exactive HF ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-GFP 1:2000 (MBL, RRID: AB_591819) rabbit anti-Halo 1:1000 (Promega, RRID: AB_713650), rat anti-HA 1:500 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary horseradish peroxidase-conjugated anti-mouse or anti-rabbit rabbit IgG antibody (Promega #W4021 and #W4011) were used at 1:2,500 dilution followed by detection by ECL (SuperSignal West Pico Chemiluminescent Substrate ...