Labshake search
Citations for Promega :
451 - 500 of 911 citations for Anti Kallikrein 7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Expression of Halo-bZIP and SBP-bZIP proteins were confirmed by western blotting using anti-HaloTag monoclonal antibody (Promega, G9211) and anti-SBPTag mouse anti-human antibody (MilliporeSigma ...
-
bioRxiv - Microbiology 2022Quote: ... a rabbit polyclonal antibody was used followed by detection with a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase and developed using a chemiluminescent substrate (Promega). Immunoblot detection of 6xHIS and 2A peptide tags were determined through anti-Histidine tag (AD1.1.10 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... The antibodies used for western blotting were: anti-HALO (1:1000 in 0.5% milk TBST, 4°C o/n, Promega G9211), anti-GAPDH (1:10000 in TBST ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed twice with 1X TBS-TT (10X TBS-TT is 10X TBS buffer with 5 mL/L Tween 20 and 5 mL/L Triton X) and once with 1X TBS before incubation with the secondary antibody (IgG anti-rabbit HRP conjugate, Promega) 1:1,000 diluted in blocking solution for 1 hr ...
-
bioRxiv - Biochemistry 2023Quote: ... The expression of FgSte3-NLuc donor protein produced was also validated performing immunoblotting using anti-Nluc antibody (Promega cat#7000), see details below.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Cell Biology 2021Quote: ... LgBiT antibody (N710A) and HiBiT antibody were acquired from Promega. Chicken polyclonal MAP2 (ab5392) ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies were detected using HRP-conjugated mouse secondary antibody (Promega). UAP56/DDX39B [1:2000] (custom generated51 ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibody was detected using HRP-conjugated chicken secondary antibody (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies were detected using HRP-conjugated rabbit secondary antibody (Promega). Anti-Beta Tubulin III (Tuj1 ...
-
bioRxiv - Genomics 2022Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:2,000 in 5% BSA in TBST) for 1 hour at room temperature followed by development in ECL (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... three washes of 10 min in PBS-T were performed and membranes were incubated 1 hour at RT with the following 1:5000 or 1:2500 horseradish peroxidase conjugated secondary antibodies in 1% milk in PBS-T: anti-mouse (Promega, #W402B), anti-rabbit (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were washed thoroughly in PBS-T before incubation with secondary antibodies (anti-rabbit horseradish peroxidase, Promega WB401B 1:2,500 dilution) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were blocked with PBS containing 5% skim milk and incubated with HRP-conjugated anti-human IgG1 antibodies (Promega, #W403B) overnight at 4 °C.
-
bioRxiv - Molecular Biology 2023Quote: ... Western blots were run according to standard procedure and probed with streptavidin IRDye680RD (Licor 925-68079) to track biotinylated HaloTag protein and anti-HaloTag antibody (Promega G928A) to track total HaloTag protein ...
-
bioRxiv - Molecular Biology 2023Quote: Western blots were run according to standard procedure and probed with streptavidin IRDye680RD (Licor 925-68079to track biotinylated HaloTag protein and anti-HaloTag antibody (Promega G928A) to track total HaloTag protein ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:2000 in 5% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:5000 in 2% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed 3 × 10 min in TBS-T (0.1%) before 1hr incubation in secondary antibodies (anti-rabbit HRP or AP conjugate (Promega; 1: 5.000)) ...
-
bioRxiv - Immunology 2023Quote: ... Secondary antibodies (Promega) were incubated for 1 h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... SEA (0.2 mg/ml) and soluble schistosomula antigens (0.2 mg/ml) was determined using the Caspase-Glo® 3/7 Assay System (Promega, Sydney, Australia) according to the manufacturers’ instructions.
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 µl of the RNA from input and supernatant and 7 µl of the pre-eluates and eluates were digested with RQ1 DNase I (Promega, Walldorf, Germany) and cDNA synthesis was carried out with Superscript IV reverse transcriptase (Thermo Fischer ...
-
bioRxiv - Microbiology 2019Quote: ... the wells were washed and 200 µl of a 1:5,000 dilution of secondary Anti-Mouse IgG antibody conjugated to HRP (Promega Corporation, Madison, WI) in PBS + 2% BSA was added to each well ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were rinsed 5 times for 8 min in PBS-tween 0.2% and incubated with secondary antibodies for 2 h at room temperature under agitation (HRP anti-mouse, 1:10000, Promega cat. # W4021). Membranes were further rinsed 5 times for 8 min in PBS-tween 0.2% ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... membrane integrity (CytoTox-OneTM homogeneous membrane integrity assay kit: lactate dehydrogenase (LDH release) and caspase activity/ apoptosis (Caspase-Glo® 3/7 assay system kit) (all from Promega, WI, USA), as described previously17 (see Supplementary data for detailed description).
-
bioRxiv - Bioengineering 2024Quote: ... 100 uL of the diluted lysate was added to each well along with an equal volume of Caspase Glo 3/7 assay reagent (Promega, Madison, Wisconsin, USA), according to the manufacturer’s directions ...
-
bioRxiv - Biophysics 2023Quote: ... The secondary antibody (Promega: anti-rabbit #W4011 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the strips were washed in TBS-T for 15 min and incubated with the secondary antibody anti-mouse IgG-HRP (Promega, Cat. no: W4028) at 1:10000 dilution in TBS-T 3 % BSA for 1h ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). For siRNA tests ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). Cells were routinely tested for mycoplasma using a MycoAlert detection kit (Lonza ...
-
bioRxiv - Plant Biology 2023Quote: ... The proteins were separated by 12% Tris–Glycine– SDS–PAGE and the gel was electroblotted to a PVDF membrane (0.2 µm) followed by immunodetection using Anti-HaloTag® Monoclonal Antibody (1:5000) (Promega, Madison, Wisconsin, United States) in Tris-buffered saline (TBS ...
-
bioRxiv - Genetics 2020Quote: ... Secondary antibodies were from Promega (catalog nos ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP Conjugate Antibody (Promega-W4021). Immuno-blots were developed using enhanced chemiluminescence (Clarity -Biorad ...