Labshake search
Citations for Promega :
451 - 500 of 1625 citations for 7 Hydroxy 4 oxo 8 propyl 4H chromene 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... serum stimulation was done with DMEM containing 15 % FBS and cells were harvested after 7 h of stimulation and SRF reporter activity was measured with Dual-Luciferase reporter assay system (E1910; Promega) and a luminometer ...
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115), 8 pmol of DNA from step 1 and 10 µL T7 HiScribe enzyme ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115) and 7 µL TGIRTIII enzyme (InGex) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL RNAse.In (Promega #N2115), 20 μL RNAse-free H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/μL RNasin (Promega), 1 μM vRNA or cRNA promoter ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: The psiCHECK-2 plasmid (Promega) has a special NheI restriction site that was used to insert a synthetic DNA duplex encoding the G-rich region of the PRCC-TFE3 fusion gene in the upstream of the renilla luciferase initiation codon to create the plasmids G4Q27 and G4M27 (mutated G-rich region of the PRCC-TFE3 fusion gene) ...
-
bioRxiv - Molecular Biology 2023Quote: ... psiCHECK-2™ (Promega, C8021) luciferase plasmids and primers used can be found in Supplemental Table S6B and Supplemental Table S7C ...
-
bioRxiv - Immunology 2022Quote: ... vRNA was isolated from plasma using the Maxwell Viral Total Nucleic Acid Purification kit (Promega) on a Maxwell 48 RSC instrument (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... A master mix of 3.5uL lysate with 0.5uL 100uM complete amino acid mix (Promega L4461) and 1uL 10x translation buffer (20mM Hepes pH 8 ...
-
bioRxiv - Microbiology 2021Quote: ... viral RNA was extracted using the Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega), subjected to DNAse treatment using TURBO DNAse (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: Maxwell® RSC Viral Total Nucleic Acid Purification Kit (cat. # ASB1330, Promega Corporation, Madison, WI) was used for RNA isolation ...
-
bioRxiv - Plant Biology 2022Quote: ... the 40 µl in vitro translation reactions contained 20 µM 19 amino acid mix (Promega) and 0.45 µCi/µl of [35S]-methionine (Hartmann Analytics) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted using the Maxwell® RSC Viral Total Nucleic Acid Purification kit (Promega), as per the manufacturer’s instructions into nuclease-free water ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were precipitated with trichloroacetic acid and digested with Lys-C (Wako) and trypsin (Promega). The peptides were then analysed using an Ultimate 3000 nano-RSLC (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Digested protein suspensions with 4 μg trypsin (Promega) in 40 μL 25 mM NH4HCO3 buffer at 37 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... 4 U RNasin Ribonuclease Inhibitor (Promega, Cat#N2115), 6 U Recombinant RNase Inhibitor (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 4 μL of RQ1 DNase (Promega, M6101) were applied to the lysate and incubated at 37 °C for 3 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 6-8 hours before dual luciferase assay was performed using the Dual-Glo Luciferase Assay (Promega) in a Synergy Neo2 microplate reader (Biotek).
-
bioRxiv - Microbiology 2021Quote: ... ∼80% confluent HeLa cells in an 8-well Ibidi slide was transfected with 500ng of pBud.pHluorin with 1.5μl of Fugene (Promega) and 50μl of Opti-MEM ...
-
bioRxiv - Immunology 2021Quote: ... 50 mM Tris-Cl (pH 8) prior to digestion with Trypsin/Lys-C Mix (Promega, Madison, WI) at a ratio of 1:25 (enzyme ...
-
bioRxiv - Biochemistry 2023Quote: ... The trypsin digestion commenced with the addition of 8 μL Gold Trypsin (0.5 mg/mL Promega V5280) along with 160 μL of 50 mM Tris pH 8 and 2 μL 100 mM CaCl2 ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the tRNA pellet was resuspended in water and incubated with 8 U of RQ1 RNAse-free DNAse (Promega) at 37 °C for 30 min according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... HMW DNA was resuspended in 10 mM Tris pH 8 and quantified by Quantus™ Fluorometer (Promega Inc). The DNA size and integrity were assessed on TapeStation™ instrument (Agilent ...
-
bioRxiv - Plant Biology 2023Quote: ... Gene of interest was amplified using designed primers (Supplementary Table 8) and cloned into pGEMT-Easy vector (Promega). Using the DIG RNA Labelling Kit (Roche Diagnostics) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 8 µg of pcDNA3.1-GFP-mNLS-K145Q using Fugene 6 Transfection reagent (Promega, E2692) per manufacturer protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid; #V542A, Promega, WI, USA), and 39 μl or 49 μl 250 mM Tris buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Ethylenediaminetetra-acetic acid (EDTA, 0.5 M, pH 8.0) and trypsin were purchased from Promega (Madison, WI). Lysyl endopeptidase (Lys-C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Sequencing grade modified trypsin with acetic acid resuspension buffer was obtained from Promega (Madison, WI, USA). Paramagnetic beads for SP3 (Sera-Mag Speed Beads A and B ...
-
bioRxiv - Genetics 2019Quote: Nucleic acids were extracted from blood samples using the Wizard genomic DNA Promega Kit (Promega Corporation). Multiplex ...
-
bioRxiv - Biochemistry 2021Quote: ... precipitated by trichloroacetic acid precipitation and digested with 1:50 (w/w) chymotrypsin (Promega, Cat #V106A) in 100 mM Tris-HCl and 10 mM CaCl2 for 18 h at 37 °C with shaking ...
-
bioRxiv - Genomics 2021Quote: ... in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega) in a Maxwell® RSC instrument following the manufacturer’s protocol ...