Labshake search
Citations for Promega :
451 - 500 of 3294 citations for 7 AMINONAPHTHALENE 1 3 DISULFONIC ACID POTASSIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 18 RNA extractions (3 morphs × 3 tissues × 2 biological replicates) were performed using the SV Total RNA Isolation System (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... and digested with 3 μg LysC (Wako) O/N at 37°C and then with 3 μg of trypsin (Promega) for eight hours at 37°C following FASP procedure (Filter-aided sample preparation 48) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Initial P0 virus was obtained by addition of ∼3 µg recombinant bacmid DNA mixed with 3 µl FuGENE HD Transfection reagent (Promega) in 100 µl Sf900 II media (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’-UTR derived from pNL1.1[Nluc] vector (Promega), and 50 nt poly(A ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Systems Biology 2020Quote: ... and T4 DNA ligase (3 U/μί, Promega) were applied to assemble all of the synthetic promoter blocks sequentially and simultaneously into the firefly reporter vector backbone in a one-pot reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... organoids were embedded in 3% agarose (Promega, #V3125), sectioned at 120-µm thickness and collected in 30% sucrose in 1× PBS for cryopreservation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA:FuGENE complexes were formed at a ratio of 1:3 (μg DNA/μL FuGENE HD) according to the manufacturer’s protocol (Promega, Madison, WI, USA). The resulting transfection complex (1 part ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-goat alkaline phosphatase-linked antibody and alkaline phosphatase substrate (5-bromo-4-choloro-3-indolyl 1-phosphate and nitroblue tetrazolium) from Promega (Southampton, UK); a hydroxamate-based MMP inhibitor CT-1746 (N1-[2-(S)-(3,3-dimethylbutanamidyl)]-N4-hydroxy-2-(R)-[3-(4-chlorophenyl)-propyl]-succinamide ...
-
bioRxiv - Microbiology 2019Quote: ... The next day they were transfected over 24 hours with a DNA-Fugene HD mixture at a ratio of 1 μg DNA to 3 μl Fugene (Promega, Southampton, UK) according to the manufacturer’s instructions (Western analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with 1 µg of DNA diluted in 45 µl dMEM and then mixed with 3 µl ViaFect™ (Promega, USA) transfection reagent added and incubate for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... approximately 200,000 HEK-293T cells were transfected with 1 μg of plasmid DNA complexed to 3 μL of FuGENE HD (Promega, Cat: E2311). 16-20 hours post transfection the cells were dissociated from the plastic using cell dissociation buffer (Gibco Cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by DNA staining with Diamond™ Nucleic Acid Dye (Promega, Madison, WI)
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 μl of premix [100 μM amino acid mixture without methionine (Promega), 100 μM amino acid mixture without leucine (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed on the ViiA 7 Real-Time PCR System using GoTaq qPCR master mix (Promega) according to the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... The mixture was then and incubated for 7min at 55°C followed by an additional 7 minute incubation with 3.5µl of SDS 0.2% (Promega, #V6551) to ensure that Tn5 was dissociated from the cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... ATP levels at day 0 and day 7 were measured using CellTiter-Glo Luminescent Cell Viability Assay (Promega). For analysis ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Molecular Biology 2019Quote: ... The siRNA target sequence was mutated from 5’-AGACCTAAGTTCTGTCGAA-3’ to 5’-CGGCCGAAATTTTGCAGGA-3’ and integrated into the pCI (Promega, E1731) plasmid for ectopic protein expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... CellTiter 96 AQueous One Non-Radiactive Cell Proliferation Assay based on 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) was from Promega (Duebendorf, Switzerland). COmplete™ EDTA-free protease inhibitor cocktail was obtained from Roche Diagnostics (Mannheim ...
-
bioRxiv - Biophysics 2019Quote: ... The N-terminal Halo-tagged vector segment was cloned by using the primer sets: 5’-GAGTAACTAGCATAACCCCTTGGC-3’ and 5’-CACTAGCCATGTTATCGCTCTGAAAGTACAGATC-3’ with the pHTN HaloTag® CMV-neo Vector (Promega) as template ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... ATRX 5’-TGAAACTTCATTTTCAACCAAATGCTC-3’ and 5’-ATCAAGGGGATGGCAGCAG-3’ All PCR reactions were performed using GoTaq® G2 DNA polymerase kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 µL of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) reagent (#G3582; Promega, Madison, WI) was added and incubated at 37°C for 45 mins ...
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified with a real time quantitative PCR (qPCR) ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Neuroscience 2021Quote: Neuronal transfections were performed on DIV 7 using a calcium phosphate kit (ProFection Mammalian Transfection System, Cat # E1200, Promega), based on a previously described method (Sando et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... For phospho-peptide samples the volume was increased to 2,000 μl (7-fold dilution) and 30 μg Trypsin Gold (Promega) was added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... selected fragments of alternatively spliced exons (Supplementary Table 7) were cloned into the pGEM®-T Easy Vector (Promega). To generate the DNA templates for transcription ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 ng/μL trypsin (Trypsin Gold, V5280, Promega, USA), 0.01 % enhancer (ProteaseMAX™ ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Immunology 2024Quote: ... IVT mRNA (3 pmol) and 10U RNase inhibitor (Promega) were then added to the cell suspension ...
-
bioRxiv - Biochemistry 2022Quote: ... Ethylenediaminetetra-acetic acid (EDTA, 0.5 M, pH 8.0) were purchased from Promega (Madison, WI). Lysyl endopeptidase (Lys-C ...
-
bioRxiv - Genomics 2021Quote: ... Total nucleic acid was then treated with DNase I as recommended (20 units; Promega), re-extracted with phenol/Sevag ...