Labshake search
Citations for Promega :
451 - 500 of 2413 citations for 4 Chloro 2 iodothieno 2 3 b pyridine 5 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... protein samples were then incubated with chymotrypsin at a ratio of 1:80 (enzyme to protein) for 3-4 h at RT and then trypsin (Promega) at a ratio of 1:80 (enzyme to protein ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of RNA was subjected to reverse transcription using M-MLV enzyme (Promega #M1705), dNTP mix 100 mM each (BLIRT #RP65 ...
-
bioRxiv - Microbiology 2020Quote: ... Protein digestion was carried out by adding 2 μg of trypsin solution (Promega, Charbonnières, France) to the alkylated proteins ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1 and 2 μL of 50 ng/μL trypsin (in 100 mM TEABC, Promega) was added to the wells with single cells and two hundred carrier cells ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed in 50 μl final volume using 2 U of GoTaq Polymerase (Promega) and 100 ng of DNA template in each reaction ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed in 50 μl final volume using 2 U of GoTaq Polymerase (Promega) and 100 ng of Nichols DNA template ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into the XhoI and HindIII sites in the psiCHECK™-2 Vector (Promega) resulting in the plasmid pTal1-Luc ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg of total RNA was used for cDNA synthesis with AMV reverse Transcriptase (Promega) together with 20 pmol of oligonucleotides O135 (5’-TAGCGGCTGATGTTGAACTG-3’ ...
-
bioRxiv - Immunology 2022Quote: ... transfected with ISD (21) at 2 µ g per dish using ViaFect (Promega, Madison, WI) at 3 µ L per 1 µ g of ISD based on manufacturer protocol ...
-
bioRxiv - Immunology 2022Quote: ... transfection with ISD (21) at 2 µ g per dish using ViaFect (Promega, Madison, WI) at 3 µ L per 1 µ g of ISD based on manufacturer recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... The samples were subjected to digestion with LysC (Wako) for 2 h and trypsin (Promega) overnight at 37°C at a 1:50 enzyme ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl of the resulting mRNA was mixed with 1 μl of FluoroTect GreenLys (Promega) and 3 μl of the wheat germ extract and then transferred under 50 μl of the translation buffer (1x SUB-AMIX SGC ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were cloned downstream of Renilla luciferase of psiCHECK(TM)-2 vector (Promega) using XhoI and NotI sites.
-
bioRxiv - Microbiology 2020Quote: ... cells were transiently transfected with 2 μg DNA using FuGENE® HD (Promega, Madison, WI). Whole-cell patch-clamp recordings were performed at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: Seedlings were sprayed with 2 mM Luciferin (VivoGlo™ Luciferin, In Vivo Grade, Promega, Netherlands) one day before they were released either into continuous light or dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each DNA family was amplified with 2×GoTaq® Hot Start Green Master Mix (Promega) using 0.8–2.2 ng of germline and somatic DNA and the primer pair according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... A volume of 2 µL of the samples was diluted in Glo lysis buffer (Promega) and incubated in a 1:1 ratio for 3 min in the dark with NanoGlo substrate ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 mg of total RNA was used for cDNA synthesis with MMLV reverse transcriptase (Promega) in final 50 mL volume ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tryptic digest was performed in 50 mM ammonium bicarbonate buffer with 2 μg trypsin (Promega) at 37 °C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were transfected with 2 µg of plasmids with FuGene HD transfection reagent (Promega #E2312) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 2 μg of bacmid DNA using Fugene HD transfection reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... and 500 µL per sample were digested using 2 µg Trypsin/LysC (Promega, Cat#V5072). After 17 h of incubation at 37°C ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 mg of total RNA was used for cDNA synthesis with MMLV reverse transcriptase (Promega) in final 50 mL volume ...
-
bioRxiv - Neuroscience 2023Quote: ... proteins on beads were digested with the addition of 2 µg trypsin (Promega, Cat# V511A) for 18 h at 37°C.
-
bioRxiv - Biochemistry 2023Quote: ... Samples were again diluted to 2 M urea and digested with 1 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Systems Biology 2023Quote: The transfections were performed with a 1 mg DNA: 2 ml Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Physiology 2022Quote: ... 2-Deoxyglucose-6-phosphate (2DGP) was measured using a Glucose Uptake-Glo Assay Kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 2-DG uptake was measured using a Glucose Uptake-Glo Assay kit (Promega, Madison, WI).
-
bioRxiv - Microbiology 2022Quote: ... Once cooled the beads were digested overnight with 2 µg of Trypsin (Promega Catalog # V5111) at 37 °C and constant rocking.
-
bioRxiv - Physiology 2022Quote: ... 2-Deoxyglucose-6-phosphate (2DGP) was measured using a Glucose Uptake-Glo Assay Kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: cDNA was synthesized from 2 ug of total RNA using GoScript Reverse Transcriptase (Promega, #A5003) with random hexamers according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... The mice received intraperitoneal (IP) injection of 2 milligrams of luciferin (Promega Corporation, Madison, WI) and subjected to luminescence imaging using an IVIS® Spectrum In Vivo Imaging System (PerkinElmer Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... pH 8.0) containing 2 nM 11S and 1/250 Nano-Glo Luciferase Assay Reagent (Promega) was added to the cells and background luminescence read for 5 min ...
-
bioRxiv - Biophysics 2024Quote: ... cells were transiently transfected with 2 µg DNA by lipofection (FuGENEⓇ HD, Promega, Madison, WI).
-
bioRxiv - Bioengineering 2024Quote: ... and codon optimized human PAH exon 2-13 coding sequence with HiBit reporter tag (Promega) and cloned into plasmid backbone with Gibson assembly ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tryptic digest was performed in 50 mM ammonium bicarbonate buffer with 2 μg trypsin (Promega) at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... and 72h in 3-5 wells for each condition (mean values of 3-5 technical replicates are provided for each donor) using a multiwell plate reader Glomax (Promega). Each 2h incubation was performed at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...