Labshake search
Citations for Promega :
451 - 500 of 3383 citations for 4 15 Oppositene 1 7 Diol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... plates were equilibrated to room temperature and 100 μL of room temperature Caspase-Glo 3/7 reagent (Promega G8091) was added to each well ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-goat alkaline phosphatase-linked antibody and alkaline phosphatase substrate (5-bromo-4-choloro-3-indolyl 1-phosphate and nitroblue tetrazolium) from Promega (Southampton, UK); a hydroxamate-based MMP inhibitor CT-1746 (N1-[2-(S)-(3,3-dimethylbutanamidyl)]-N4-hydroxy-2-(R)-[3-(4-chlorophenyl)-propyl]-succinamide ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The following day cells were trypsinized and seeded in 384-well white plate (20 µl/well) in DMEM F12 (no phenol red, 4% FBS) +/-HaloTag® NanoBRET™ 618 Ligand (1 µl/ml, Promega) and +/-compounds (DMSO concentration in each sample was kept the same) ...
-
bioRxiv - Systems Biology 2023Quote: ... and digested using LysC 1:100 enzyme:proteins ratio for 4 hours (Wako sequencing grade, 125-05061) and trypsin 1:100 enzyme:proteins ratio for 16 hours (Promega sequencing grade, V5111). The digested proteins were then acidified with 10% (v/v ...
-
bioRxiv - Systems Biology 2023Quote: ... Proteins were digested using LysC 1:100 enzyme:proteins ratio for 4 hours (Wako sequencing grade, 125-05061) and trypsin 1:100 enzyme:proteins ratio for 16 hours (Promega sequencing grade, V5111). The digested proteins were then acidified with 10% (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then pelleted at 300g for 7 minutes and resuspended in 200μL of Homogenization Buffer from the Maxwell RSC simplyRNA Tissue Kit (Promega #AS1340). Cells were then lysed by adding 200μL of lysis buffer and transferred into the Maxwell RSC Cartridge ...
-
bioRxiv - Neuroscience 2020Quote: Caspase 3/7 activity in primary neuronal cells was measured using ApoTox-Glo Triplex Assay kit (Promega, Madison, WI, USA) as per the manufacture’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... the whole lane was cut in 7 bands and digested, as described (Shevchenko et al, 1996) with sequencing-grade trypsin (Promega). For the ubiquitination analysis ...
-
bioRxiv - Microbiology 2020Quote: Apoptosis induction by T3DC and inhibition by Z-VAD-FMK was determined using the Caspase-Glo 3/7 Assay System (Promega). PC3 cells were plated at 1 × 104 cells per 96 well plate and 24 h later were either treated with docetaxel ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Pro-apoptotic caspase 3/7 activation was measured in worms harvested from mice following drug treatment using the Caspase-Glo 3/7 Assay Kit (Promega). Worms were harvested from either the mesenteries or liver of mice ...
-
bioRxiv - Cell Biology 2020Quote: Measurements of caspase activities in cells were performed using the commercially available Caspase-Glo 3/7 Assay (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... cell viability followed by caspase 3/7 activity were measured using CellTiter-Fluor™ Cell Viability Assay kit (Promega, G6080) and Caspase-Glo® 3/7 Assay System (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: ... the MCF-7 and MDA-MB-231 cells were infected with Plasmids expressing RFP or GFP using Fugene 6 (Promega) at an early passage and were selected using 2 μg/ml puromycin (Sigma).
-
bioRxiv - Cancer Biology 2021Quote: ... Cell number was measured after 3 and 7 days and normalized to the initial reading at day 0 using the CellTiter Glo Luminescent Cell Viability Assay (Promega). The experiments shown represent fold change at day 7 relative to day 0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MCF-7/CA-IX cell lines by standard clonogenic stable cell construction procedures using Fugene HD (Promega, E 2311). The U2-OS and HEK-293 cells transfected with empty pCMV6 (PS10001 ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... using Lipofectamine 2000 and assays were performed 48 hours later using the Apo-ONE Homogeneous Caspase-3/7 Assay (Promega). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... DNA used for microarray was isolated from frozen cell pellets (3×106-7×106 cells) using the Maxwell RSC Cultured Cells DNA Kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... Necrosis was quantified by measuring release of lactate dehydrogenase in 30 µl samples of the medium and apoptosis by determining cell-associated Caspase3/7 activity using the respective kits from Promega Corp. ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... serum stimulation was done with DMEM containing 15 % FBS and cells were harvested after 7 h of stimulation and SRF reporter activity was measured with Dual-Luciferase reporter assay system (E1910; Promega) and a luminometer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were collected at indicated time points and mixed with equal parts Promega Caspase-Glo 3/7 reagent (Promega G8090) and incubated for 45 min ...
-
The myokine FGF21 associates with enhanced survival in ALS and mitigates stress-induced cytotoxicitybioRxiv - Neuroscience 2024Quote: ... following the manufacturer’s instructions and as previously described.25 Apoptosis was detected by caspase activity using Caspase-Glo 3/7 assay kit (Promega) following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptotic and viability effects of CM-272 on treated primary AML cells was investigated by the Caspase-Glo 3/7 assay (G8981, Promega) following the manufacturer’s instructions and measured in the FLUOstar Omega microplate reader ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein samples (15 µg) were digested overnight at 37 °C with trypsin (Promega, Madison, WI-USA) in a protein:trypsin ratio of 50:1 (w/w) ...
-
bioRxiv - Biochemistry 2024Quote: ... plates were equilibrated to RT for 15 min and CellTiter Glo reagent (Promega, Madison, WI, USA) was added followed by orbital shaking for 2 min ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was purified from 10-15 midguts using the ReliaPrep RNA Tissue Miniprep System (Promega). cDNA was made from 100 or 200 ng of RNA using PrimeScript RT Reagent Kit (TaKaRa) ...
-
bioRxiv - Cancer Biology 2022Quote: SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
bioRxiv - Microbiology 2021Quote: ... Digested protein suspensions with 4 μg trypsin (Promega) in 40 μL 25 mM NH4HCO3 buffer at 37 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... 4 U RNasin Ribonuclease Inhibitor (Promega, Cat#N2115), 6 U Recombinant RNase Inhibitor (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 4 μL of RQ1 DNase (Promega, M6101) were applied to the lysate and incubated at 37 °C for 3 min ...
-
bioRxiv - Plant Biology 2022Quote: ... as primary antibodies and anti-mousse IgG-HRP conjugated secondaries antibodies (Mouse IgG, HRP conjugate W402B, Promega; 1/5000 in TBST, 4 hours). As a loading control we used anti-tubulinα antibodies as primary antibodies (1/1000 in 5 % milk over-night) ...
-
bioRxiv - Biochemistry 2023Quote: ... and 20 µL of 1:1000 (diluted in phenyl red-free DMEM with 4% FBS) HaloTag™ NanoBRET™ 618 Ligand (Promega G9801) was added to each well ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were processed at different times post inoculation (pi) according to manufacturer’s instructions (Caspase-Glo® 3/7 Assay kit, Promega, USA) to determine caspase 3/7 activity ...
-
bioRxiv - Molecular Biology 2020Quote: ... lysed by rocking for 15 min at room temperature in 500 μL of Passive Lysis Buffer (Promega), and clarified by centrifugation at 21,000 × g for 2 min ...
-
bioRxiv - Biochemistry 2022Quote: ... after which the dsDNA template was degraded for 30 minutes with 15 units of RQ1 DNAse (Promega). The transcribed sgRNA was PAGE purified on an 8% denaturing polyacrylamide gel containing 7 M urea ...
-
bioRxiv - Molecular Biology 2020Quote: shERH plasmids were diluted in 500 μl of OPTI-MEM with 15 μl of Fugene HD (Promega) and mixed well with rapid pipetting ...