Labshake search
Citations for Promega :
451 - 500 of 4059 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 2 mM DTT, 100 μg ml-1 cycloheximide [Sigma], 20 U ml-1 RNase inhibitor [Promega] ...
-
bioRxiv - Cell Biology 2024Quote: ... U2OS cells were transfected with 1 μg of pX330 plasmid and 1 μg of the HDR donor plasmid using 1 ug FuGene 6 (Promega). Approximately 2-3 days post-transfection ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were diluted 1:100 in 1 × passive lysis buffer (Promega) and 5 µl were transferred into a white Nunc 96-well plate ...
-
bioRxiv - Genomics 2023Quote: ... Samples were then diluted 1:1 with MilliQ water and trypsin (Promega) added at the same enzyme to protein ratio ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µl forward primer and 1 µl reverse primer (Promega corporation, USA), 3 µl extracted DNA and 14 µl nuclease free water and initial denaturation at 95°C for 10 minutes followed by 35 cycles including annealing temperature which varied in different reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ml DMEM containing 1 % (v/v) triton X-100 (Promega, UK) was then added to each well with vigorous pipetting to detach and disrupt cells from the well surface ...
-
bioRxiv - Microbiology 2022Quote: ... the virus-induced cytopathogenic effect was measured colorimetrically by the formazan-based 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) cell viability assay (CellTiter 96 AQueous One Solution Cell Proliferation Assay from Promega, Madison, WI), and the antiviral activity was expressed as the 50% effective concentration (EC50) ...
-
bioRxiv - Genomics 2022Quote: The 293T cells in 96-well plates were transiently transfected with 200 ng Firefly luciferase vector (pGL3) and 4 ng pRL-TK Renilla luciferase vector (Promega, Madison, USA) using 0.5 uL Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... 30 μg of protein was digested with Lys-C (FUJIFILM Wako Chemicals Europe GmbH, Germany) for 4 h and subsequently with modified porcine trypsin (Promega, WI, USA) for 16 h at 37 °C.
-
bioRxiv - Plant Biology 2020Quote: ... The columns were capped at the bottom and 200 µl AmBic containing 4 ng/µl of Trypsin + LysC (Promega Catalog number V5073) was added to each sample and incubated in a 37°C shaker for 16 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pelleted cells were disrupted by glass beads agitation at 4°C in 1x Passive Lysis Buffer provided in the Dual-Luciferase® Reporter Assay System (Promega, #E1910). Extracts were clarified by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... The clear supernatant was incubated overnight at 4°C with 100 μl of prewashed Magne® HaloTag® Beads (Promega, WI, USA). Post-incubation ...
-
bioRxiv - Genomics 2023Quote: ... Primers bearing kpnI and BgLII sites (Additional Table 4) allowed incorporation into pGL3-Basic reporter vector containing luciferase gene from the firefly Photinus pyralis (Promega, Wisconsin, USA). Amplification was carried out using Phusion HotStart II Polymerase ...
-
bioRxiv - Immunology 2023Quote: ... 4 µl of cDNA per sample were used and qRT-PCR was performed using the GoTaq® qPCR Master Mix (Promega, #A6001) on a LightCycler 96 (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Luminescence was measured 24 h after plating (T0) and after 4 d using the CellTiter-Glo Luminescent Cell Viability Assay protocol (Promega; cat# G7573). When indicated ...
-
bioRxiv - Genetics 2023Quote: ... 3,500,000 cells were seeded in 10 cm plates (2-4 per replicate) and transfected with FuGENE® 6 Transfection Reagent (Promega, E2692). In one tube ...
-
bioRxiv - Microbiology 2024Quote: ... Cells infected with viruses expressing luciferase were harvested 4 days after infection and analyzed for luciferase activity with a luminescence kit (Bright-Glo™ Luciferase Assay System, Promega, E2620) as described in (61).
-
bioRxiv - Microbiology 2020Quote: ... 1 U RNasin (Promega) and 1 mM DTT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1:1,000 RNasin (Promega)) using a 2ml Dounce homogeniser ...
-
bioRxiv - Neuroscience 2020Quote: ... furimazine (Promega, 1:2000), 20 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... 1× Protease inhibitor (Promega), 0.1 mM DTT (Thermo Fisher)] per 100 mg of tissue with 15 strokes of the loose and 15–20 strokes of the tight pestle ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µl DTT (Promega), in 20 µl Superscript II buffer (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μg trypsin (Promega) was added to the S-trap for 90 minutes at 47 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... or (1:25,000) (ProMega) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1 % RNasin (Promega), and incubated for 15 min at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 mM luciferin (Promega), 14.5 mM NaHCO3 (Sigma) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5ml 1% digitonin (Promega), 0.5ml 10% Tween-20 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:10000 (Promega: W4021) and in 3.5% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 x buffer (Promega), 2.5 mM MgCl2 ...
-
bioRxiv - Immunology 2024Quote: ... 0.5μL 1% digitonin (Promega) and 22uL water ...
-
bioRxiv - Cell Biology 2024Quote: ... Trypsin (1 μg; Promega) was added in 60 μL of 40 mM ammonium bicarbonate buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Biophysics 2022Quote: ... The embryos were then incubated in a 1:5,000 dilution of TMR HaloTag Ligand (5 mM; Promega) in Danieau’s medium ...
-
bioRxiv - Plant Biology 2024Quote: ... The secondary antibody (Goat anti-rabbit IgG HRP, Promega, diluted 1:133333 in 5% milk in PBS) was then applied for 50 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... that included (for 1 well): 5 μl of the SYBR Green Real-Time PCR master mix (Promega), 1.25 μl of the forward and reverse primer (standardized KiCqStartTM primers ...
-
bioRxiv - Cell Biology 2021Quote: ... psPAX2 and pMD2.G at the ratio of 1:1:1 in HEK293T cells using ProFection Mammalian Transfection System (Promega, E1200), medium was changed 16h post transfection and virus containing supernatant was harvested 48h later ...
-
bioRxiv - Biochemistry 2020Quote: ... three washes of 10 min in PBS-T were performed and membranes were incubated 1 hour at RT with the following 1:5000 or 1:2500 horseradish peroxidase conjugated secondary antibodies in 1% milk in PBS-T: anti-mouse (Promega, #W402B), anti-rabbit (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 1:2000 RealTime-Glo MT Cell Viability Assay Substrate (to visualise Nluc, first diluted 1:1 in DMSO, Promega G9711).
-
bioRxiv - Molecular Biology 2020Quote: Gently re-suspend cells in 100 μl of 3% Glyoxal fixation solution with 1:25 RNasin Plus (Promega N261B) and incubate for 15 minutes on ice.
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was quantified to 3 μg to react 1 μg/μL random hexamer (C1181; Promega, Madison, WI, USA) at 70°C for 5 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...