Labshake search
Citations for iNtRON Biotechnology :
1 - 50 of 98 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Parasite cultures and host cell lines were shown to be negative for mycoplasma using an e-Myco plus kit (Intron Biotechnology).
-
bioRxiv - Genomics 2024Quote: ... gel electrophoresis was performed using a 1.5% agarose gel with RedSafe™ Nucleic Acid Staining Solution (20,000x) (iNtRON Biotechnology) run at 100 V for 30 minutes.
-
bioRxiv - Microbiology 2024Quote: ... The cultures were incubated at 37°C with 5% CO2 and routinely checked for mycoplasma contamination using the e-Myco Plus kit from Intron Biotechnology. Human hepatocellular carcinoma cells (HepG2 ...
-
bioRxiv - Microbiology 2024Quote: DNA was obtained from the xylem tissue collected during each sampling period using the i-genomic Plant DNA Extraction Mini Kit (Intron Biotechnology, Seongnam, KR). To measure the DNA yields from each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... An e-Myco VALiD Mycoplasma PCR Detection Kit (iNtRON Biotechnology) was used to confirm that the culture was free of Mycoplasma.
-
Sense codon-misassociated eRF1 elicits widespread ribosome stalling and induction of quality controlbioRxiv - Molecular Biology 2024Quote: ... via an e-Myco VALiD Mycoplasma PCR Detection Kit (iNtRON Biotechnology) and were confirmed to be free of infection.
-
bioRxiv - Microbiology 2024Quote: ... The HCT-8 cells were determined to be mycoplasma negative using the e-Myco plus kit (Intron Biotechnology).
-
bioRxiv - Microbiology 2024Quote: ... The products were electrophoresed in 1X Tris-Acetate-EDTA Buffer (iNtRON Biotechnology, Inc., Korea) at 100 V for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... Host cell lines were tested negative for mycoplasma using an e-Myco plus kit (Intron Biotechnology). Compounds were diluted to 2X concentration ...
-
bioRxiv - Microbiology 2024Quote: ... stained with RedSafe (iNtRON biotechnology) and visualized by UV transillumination ...
-
bioRxiv - Bioengineering 2024Quote: ... cellulosilyticus using LPS Extraction Kit (Intron Biotechnology, South Korea) following the protocol as recommended by the manufacturer.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Amplification of the AP1 regulatory fragment described in28 was performed with i-MAX II DNA Polymerase (iNtRON Biotechnology – R019-220701.51) using the primers 5’ACGAGCTTAGATTCTTTTAGTTTTGC3’ and 5’GAACCAAACAAAACAAAGACCCC3’.
-
bioRxiv - Evolutionary Biology 2024Quote: LFY cDNA clones (ABRC DQ447103 and TOPO-U09-C11) were used to amplify LFY using i- MAX II DNA Polymerase (iNtRON Biotechnology – R019-220701.51) and the primers 5’AGATCTATGGATCCTGAAGGTTTCACGAG3’ and 5’GAATTCCTAATCCATGGCGAAACGCAAGTCGTCGCCG3’ ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting plasmids from the transformants were purified using a DNA-spin Plasmid DNA Purification kit (iNtRON Biotechnology, Korea), and then sequenced by primer walking at Macrogen Inc ...
-
bioRxiv - Microbiology 2023Quote: ... and amplicons approximately 2–3 kb in size were excised from the gel and purified using the Quick-spin PCR Product Purification Kit (iNtRON Biotechnology, Korea). The amplicons were further cloned in pJET1.2 cloning plasmid (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from intestinal organoids using Easy-BLUE™ RNA isolation kit (iNtRON Biotechnology, #17061). One 1 µg of total RNA was processed for preparing mRNA sequencing library using MGIEasy RNA Directional Library Prep Kit (MGI ...
-
bioRxiv - Cell Biology 2023Quote: Easy-BLUE™ RNA isolation kit (iNtRON Biotechnology, #17061) is used for total RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... Immunoreactivity was detected by Chemi-Doc using WEST-Queen™ kit (iNtRON Biotechnology, #16026).
-
bioRxiv - Molecular Biology 2023Quote: ... The Mycoplasma-free culture was confirmed by an e-Myco VALiD Mycoplasma PCR Detection Kit (iNtRON Biotechnology). A disposable cultivation chamber (DCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cell culture was routinely tested for Mycoplasma contamination with the e-Myco VALiD Mycoplasma PCR Detection Kit (iNtRON Biotechnology) and confirmed to be negative.
-
bioRxiv - Microbiology 2023Quote: ... Typhimurium LPS using the LPS extraction kit (iNtRON Biotechnology, Inc.), following the manufacturers protocol ...
-
bioRxiv - Immunology 2023Quote: ... The extracted RNA was used to synthesize complementary DNA (cDNA) using RT-premix (Intron Biotechnology, Seoul, Korea) containing an oligo-dT primer ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNAs were extracted using Easy-spin total RNA extraction kit (iNtRON Biotechnology, Seoul, Korea). In RNA-seq experiment ...
-
bioRxiv - Microbiology 2023Quote: Lipopolysaccharide was extracted from overnight bacterial cultures using an LPS extraction kit (iNtRON Biotechnology, Seoul, Korea) as directed ...
-
bioRxiv - Immunology 2023Quote: ... Extracted RNA was used for synthesizing complementary DNA (cDNA) using RT-premix (Intron Biotechnology, Seoul, Korea) containing an oligo-dT primer ...
-
bioRxiv - Microbiology 2023Quote: ... All strains and host cell lines were determined to be mycoplasma-negative using the e-Myco Plus Kit (Intron Biotechnology). Strains used in this study are listed in Table S4 ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from each sample was extracted using easy-BLUE™ Total RNA Extraction Kit (iNtRON Biotechnology, 17061), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... All cell lines were mycoplasma tested prior to freezing down stocks and prior to experiments using the e-Myco™ VALiD Mycoplasma PCR Detection Kit (iNtRON Biotechnology, Inc., CAT #25239).
-
bioRxiv - Immunology 2023Quote: ... the pellet was processed with 100 μL of PROPREP reagent (iNtRON Biotechnology Co., Ltd. Japan), followed by incubation on ice for 20 min ...
-
bioRxiv - Genetics 2023Quote: ... Samples were resolved on 10% polyacrylamide gels in Tris-borate- EDTA buffer and bands were visualized with RedSafe Nucleic Acid Staining Solution (iNtRON Biotechnology, Seongnam, South Korea). Gels were imaged using a ChemiDoc MP Imaging System (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: Cells were confirmed to be mycoplasma-negative (e-Myco plus Mycoplasma PCR Detection Kit, iNtRON Biotechnology).
-
bioRxiv - Neuroscience 2023Quote: ... gels stained with 0.01 % RedSafe (INtron Biotechnology, 21141) using Perfect Blue Gel System (Peqlab) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5X TAE buffer (cat. no. IBSD-BT002; iNtRON Biotechnology, Gyeonggi-do, Korea) and Certified™ Molecular Biology Agarose (cat ...
-
bioRxiv - Developmental Biology 2023Quote: The Easy-Blue™ total RNA isolation kit (iNtRON Biotech) was used to isolate total RNA from cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... Chemiluminescence was detected using the Miracle-Star (#16028, iNtRON Biotechnology) kit or West-Queen (#16026 ...
-
bioRxiv - Developmental Biology 2023Quote: ... kit or West-Queen (#16026, iNtRON Biotechnology) kit.
-
bioRxiv - Developmental Biology 2023Quote: ... GKO and PJ1 cellusing Easy-BLUETM RNA isolation kit (iNtRON Biotechnology, #17061). One 1 µg of total RNA was processed for preparing mRNA sequencing library using MGIEasy RNA Directional Library Prep Kit (MGI ...
-
bioRxiv - Molecular Biology 2023Quote: ... (e-Myco VALiD Mycoplasma PCR Detection Kit, iNtRON Biotechnology).
-
bioRxiv - Cell Biology 2022Quote: ... The final product was run in a 1.5% agarose gel with RedSafe (INtRON Biotechnology).
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from liver tissues using an easy-spinTM total RNA extraction kit (Intron Biotechnology, Korea) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... The gel was soaked in 1× TAE buffer containing 0.5 μg/ml RedSafe (INtRON Biotechnology, Burlington, MA, USA) for 30 min and then visualized in a UV transilluminator.
-
bioRxiv - Plant Biology 2022Quote: ... the nucleic acids were resuspended in MilliQ water and examined in 1% agarose gels stained with RedSafe (iNtRON Biotechnology, South-Korea) under UV light.
-
bioRxiv - Immunology 2022Quote: ... and reverse-transcribed using RT-Premix (Intron Biotechnology). PCR was performed with the following primers (the respective forward and reverse pairs are indicated) ...
-
bioRxiv - Cell Biology 2022Quote: ... The amino acid substitution methods were used to construct Ano9 mutants using a site-directed mutagenesis kit (Muta-Direct™, Intron Biotechnology). The construction of mutants was verified with DNA sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: Total mRNAs were extracted from cultured cells using Easy-BLUE solution (Intron Biotechnology, Seongnam, Korea) and reverse-transcribed with a cDNA synthesis kit (BioAssay ...
-
bioRxiv - Genomics 2022Quote: ... containing 15 µl of 2X i-TaqTM mastermix (iNtRON Biotechnology, Gyeonggi, South Korea), 10 µM to 50 µM of each primer and template DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR product was obtained with Maxime PCR Premix (i-pfu) (Intron Biotechnologies). pLPCX vector was digested and then dephosphorylated before ligation using the Rapid DNA Dephos & Ligation Kit (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized from 1 μg of total RNA with a Maxime RT PreMix kit (iNtRON Biotechnology, Gyeonggi, Korea) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... rinsed with PBS and lysed with 50 µL of Pro-Prep protein extraction solution (iNtRON Biotechnology). After centrifugation at 15,000 rpm for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... All cultured cell lines were routinely tested for mycoplasma contamination every 3 months using a e-Myco VALID Mycoplasma PCR Detection Kit (iNtRON Biotechnology, Inc., cat# 25239).