Labshake search
Citations for Tecan :
3001 - 3050 of 4358 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Fluorescence intensity was measured with a fluorescence spectrometer microplate reader (Tecan Infinite 200 PRO, Tecan, Switzerland) after washing twice with binding buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we incubated them overnight at 37°C and quantified bacterial growth by measuring optical density at 600nm (OD600) with a microplate reader (Infinite® 200 PRO, Tecan Trading AG, Switzerland) at the beginning and end of the experiment (0h and 24h) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Drosophila AnyDeplete Universal kit (Tecan, Männedorf, Switzerland). Samples were sequenced on the Illumina NextSeq500 using 75bp single-end reads at the Northwestern Sequencing Core (NUCore).
-
bioRxiv - Microbiology 2021Quote: ... then measured steady-state polyP-DAPI fluorescence of these samples (ex. 415 nm, em. 600 nm) (15) in an Infinite M1000 Pro microplate reader (Tecan Group, Ltd.). We determined the polyP content of each sample (calculated in terms of individual phosphate monomers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and incubated with orbital shaking in an M200 plate reader (Tecan, Inc.) at 28°C for 24 hours ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Bacteria were inoculated at a starting density of OD600 = 0.0001 and incubated at 37°C for 24 hours in a multimode plate reader (Tecan, Männedorf, Switzerland). Cultures were shaken every 15 minutes for 15 seconds before measuring growth (OD600) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Plates were read by an automated growth measurement system (Tecan, Austria) every 35-45 minutes for 18 hrs ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We quantified isolated DNA with a TECAN Infinite M1000 microplate reader (Tecan Trading AG, Switzerland). We then prepared tagmentation-based whole genome libraries for low coverage sequencing by enzymatically shearing DNA diluted to approximately 2.5 ng/ul using the Illumina Tagment DNA TDE1 Enzyme and Buffer Kits (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... Relative cholesterol concentration was determined for each sample by measuring fluorescence activity with a fluorescence microplate reader (Tecan Infinite 200 PRO, reading from bottom) with excitation wavelength of 530 nm and an emission wavelength of 585 nm ...
-
bioRxiv - Microbiology 2021Quote: ... Relative RBD binding was determined in quintuplicate for each condition by measuring fluorescent activity with a fluorescence microplate reader (Tecan Infinite 200 PRO) with excitation wavelength of 630 nm and an emission wavelength of 680 nm.
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared from 1 ug of total RNA using a NuGen Universal Plus mRNA-seq Library Prep Kit (Tecan Genomics Inc. Redwood City, CA, USA). Final library products were quantified using the Qubit 2.0 Fluorometer (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Neuroscience 2021Quote: ... luminescence was measured on the Infinite® 200 Pro plate reader (Tecan Life Sciences) using no attenuation ...
-
bioRxiv - Neuroscience 2021Quote: ... Fluorescence was measured on the Infinite® 200 Pro plate reader (Tecan Life Sciences) using an emission wavelength of 530 nm and an integration time of 40 µsec ...
-
bioRxiv - Neuroscience 2021Quote: ... luminescence was measured on the Infinite® 200 Pro plate reader (Tecan Life Sciences) using no attenuation ...
-
bioRxiv - Neuroscience 2021Quote: ... Fluorescence intensity (380nm excitation; 510 nm emission) was measured on a the Infinite M200 Pro fluorometric reader (Tecan). Mice treated with VEH and not undergoing fear conditioning were considered as representing baseline HDAC activity (normalized to one-fold) ...
-
bioRxiv - Neuroscience 2021Quote: ... MT polymerization was fluorometrically assayed (excitation at 360 nm, emission at 465 nm) using Infinit F-200 Microplate Reader (TECAN, Männedorf / Switzerland) at 1 min intervals for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... and microplate reader (infinite 200 PRO, TECAN Life Sciences). Assay procedures were performed in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Spectra from whole sample wells were measured on a plate reader (Spark20M, Tecan). Data represents averaged results from N=4 experimental replicates with standard deviations ...
-
bioRxiv - Neuroscience 2021Quote: ... the amount of color formed (proportional to the number of damaged cells) was measured using an Infinite M200 Pro plate reader (Tecan) at a wavelength of 490 nm.
-
bioRxiv - Neuroscience 2021Quote: ... The measurement was conducted by mixing 2 µL of rat plasma samples and 200 µL of reagent and absorbance was measured using the microplate reader Infinite 200 PRO (Tecan Trading AG, Switzerland) after 10 minutes at 500 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... by taking OD600 measurements every two hours for 48 hours while incubating at 30°C with double-orbital shaking in a Spark plate reader (Tecan, Switzerland).
-
bioRxiv - Molecular Biology 2021Quote: Luminance signal was measured using 0.5 s intervals after ligand addition (TECAN, 25°C). Concentration-responses were generated from the peak response ...
-
bioRxiv - Molecular Biology 2021Quote: ... Crystal violet stain retained by attached cells was eluted by adding 100 μl of 30% acetic acid(47) to each well and quantified using a micro plate reader (Tecan Infinite M1000 PRO) at 550nm wavelength ...
-
bioRxiv - Neuroscience 2021Quote: ... (Tecan Freedom EVO). SHANK3 forward primer 5′ acgaagtgcctgcgtctggac 3′ ...
-
bioRxiv - Neuroscience 2021Quote: ... with Magellan Reader software (Tecan Group, Ltd, Switzerland). For the calculation of results we used a 4-parameter curve.
-
bioRxiv - Molecular Biology 2021Quote: ... Relative fluorescence units (RFUs) were determined using a plate reader (Tecan, Männedorf, Switzerland) for 100 min at 28 °C with measurements every 5 minutes (excitation/emission wavelengths ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reaction was stopped with 10 µl per well Quanta RedTM stop solution and fluorescence readout was performed at 570 nm excitation and 600 nm emission using an Infinite M200 plate reader (Tecan, Männerdorf, Switzerland).
-
bioRxiv - Molecular Biology 2021Quote: ... cells were grown in 1.5 ml of SC media at 30°C with shaking at 230 rpm in an automated Infinite 200 incubator (Tecan). For time course experiments and protein isolation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were generated using the Ovation Ultralow v2 kit (NuGEN/Tecan, 0344) and subjected to 50-bp single-end sequencing on an Illumina HiSeq 2500 at the Fred Hutchinson Cancer Research Center genomics facility ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were prepared from 5 ng of RNA using the Ovation SoLo kit (NuGEN/Tecan, custom AnyDeplete; contact Tecan for ordering this kit for yeast). Libraries were subjected to 50-bp paired-end sequencing on an Illumina HiSeq 2500 at the Fred Hutchinson Cancer Research Center genomics facility ...
-
bioRxiv - Molecular Biology 2021Quote: ... EGFP fluorescence in protein samples was measured in a 96 well microplate using Tecan Genios Pro fluorescence microplate reader (Tecan, Switzerland). The results were normalized to the protein concentration in samples ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were prepared from 5 ng of RNA using the Ovation SoLo kit (NuGEN/Tecan, custom AnyDeplete ...
-
bioRxiv - Molecular Biology 2021Quote: ... An InfiniteR F200 Pro microplate reader and associated i-control™ 1.9 software (Tecan) was used to monitor Alexa Fluor 488 fluorescence every 10 seconds for 20 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... “Excitation” was set to “Filter” for measuring using a Spark® 20M multimode reader (Tecan). The following formulae were used for calculating the app ...
-
bioRxiv - Molecular Biology 2021Quote: Binding experiments with TAMRA-labeled nsp1 were conducted using a Spark multimode microplate reader (TECAN). The final concentration of labeled nsp1 was limiting (5-10 nM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The raw luminescence values were measured by TECAN SPARKCONTROL.
-
bioRxiv - Molecular Biology 2021Quote: ... Fluorescence was measured at wavelengths 570 nm excitation and 600 nm emission using a microplate reader (INFINITE M1000 PRO, Tecan Trading AG, Switzerland).
-
bioRxiv - Molecular Biology 2021Quote: ... Luminescence readings were taken on a microplate reader (Tecan Infinite 200 Pro, Switzerland). All luciferase activities were normalized to the activity level measured for no purine treatment and named as fold change (FC).
-
bioRxiv - Molecular Biology 2021Quote: ... Luminescence emission was measured every 30 s for 10 min on a microplate reader (Tecan Infinite 200 Pro, Switzerland) set with 1,000 ms for integration time ...
-
bioRxiv - Cancer Biology 2021Quote: ... Luminescent signals were measured by Tecan M200 microplate reader (integration time 0.5 sec at 26 °C) ...
-
bioRxiv - Immunology 2021Quote: ... Assays were performed in 384-well plates (Grenier) using a Fluent Automated Workstation (Tecan). IgGs starting at 150 µg/ml ...
-
bioRxiv - Immunology 2021Quote: ... Absorbance at 490 nm was measured on a Tecan Spark® multimode microplate reader (Tecan Trading AG, Switzerland).
-
bioRxiv - Immunology 2021Quote: ... and measured in a Genius luminometer (TECAN, Maennedorf, Switzerland). Each experiment was performed at least three times ...
-
bioRxiv - Immunology 2021Quote: ... Fluorescence was measured with a microplate reader (Tecan, Switzerland). Emission intensity was acquired at 440 and 490 nm (excitation=385 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... Measurements were taken immediately after addition of substrate mix by Tecan Infinite Lumi plate reader ...
-
bioRxiv - Biochemistry 2021Quote: FRET was determined by measuring the fluorescence signals in microplate reader (TECAN infinite F200 ...
-
bioRxiv - Biochemistry 2021Quote: FRET was determined by measuring the fluorescence signals in microplate reader (TECAN infinite F200, Tecan Group Ltd, Switzerland) before and 10 minutes later after the addition of the dNTPs ...
-
bioRxiv - Biochemistry 2021Quote: ... Evolution of the absorbance at 414 nm (ABTS cation radical) was measured over time with a Tecan Infinite M200 (Tecan, Switzerland) plate reader ...
-
bioRxiv - Biochemistry 2021Quote: ... The ThT fluorescence was recorded using a Tecan infinite M200 microplate reader (Tecan, Männedorf, Switzerland) with excitation and emission wavelength set to 440/9 nm and 482/20 nm ...
-
bioRxiv - Bioengineering 2021Quote: ... The absorbance at 565 nm was measured by microplate reader (Infinite M Plex by Tecan) to quantify living cells.