Labshake search
Citations for PNA Bio :
1 - 50 of 121 citations for Recombinant Swine CCL19 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant Cas9 protein (PNA Bio) and sgRNAs were injected at concentrations of 400 ng/µl of Cas9 protein and 100 ng/µl for each sgRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... purified recombinant Cas9 protein (PNA Bio, 300ng/ul) and donor plasmid (500ng/ul ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant Cas9 protein (900 ng μl−1; PNA Bio, #CP01-20) was co-injected with both sgRNAs (20μM each ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant Cas9 protein containing a nuclear localization signal (PNA Bio Inc) was reconstituted to a solution of 1 mg/mL Cas9 protein in 20 mM HEPES ...
-
bioRxiv - Developmental Biology 2020Quote: ... the protein Cas9 (recombinant cas protein from S. pyogenes PNA Bio CP01, final concentration 100 ng/μL) and KCL (final concentration 200 mM) ...
-
bioRxiv - Neuroscience 2020Quote: ... before adding recombinant Cas9 protein (300 ng/µL; PNA Bio, CP01-200) for embryo injection.
-
bioRxiv - Developmental Biology 2020Quote: ... Recombinant Cas9 protein was obtained commercially (PNA Bio Inc., Newbury Park, California, USA). Ribonucleoprotein complexes (RNPs ...
-
bioRxiv - Developmental Biology 2020Quote: ... Recombinant Cas9 protein with NLS sequence (800 ng/μl; PNA Bio, #CP01-20) was co-injected with each gRNA (500ng/μl ...
-
bioRxiv - Neuroscience 2020Quote: ... We directly mixed recombinant Cas9 protein (300 ng/µL; PNA Bio, CP01-200), sgRNA (80 ng/µL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Injection solutions consisted of combinations of Cas9 recombinant protein (PNA Bio, CP-01) 1 μg μl−1 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cas9 recombinant protein with nuclear localization signal (260 ng/μl; PNA Bio, USA) was co-injected with the gRNA (140ng/µl ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 μg of purified recombinant SpCas9 protein (PNA Bio, Inc., Thousand Oaks, CA, USA) was pre-complexed on ice for 20 min with 10 μg of the chemically modified sgRNA (bearing 2’-O methyl phosphorothioate- modified nucleotides at the first 3 and last 3 positions of the synthetic sgRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... The CRISPR injection mixture contained 300 ng/µl recombinant Cas9 protein (PNA Bio CP01) and 40 ng/ µl sgRNA (per guide ...
-
bioRxiv - Neuroscience 2022Quote: ... USA) and 1μl recombinant Cas9 protein (1 μg/μl, PNA Bio, Thousand Oaks, CA, USA) and 2μl RNAse-free water ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... It includes the Recombinant Cas9 protein with NLS sequence (1500 ng /μl−1; PNA Bio, CP0120) and the sgRNA (750 ng/ μl−1) ...
-
bioRxiv - Genetics 2021Quote: ... ubi:delta-EGFP was generated by injecting in vitro-transcribed sg RNA and recombinant Cas9 protein (PNA Bio) into ubi:Switch zygotes (Burger et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... sgRNA activity was confirmed by in vitro cleavage assays with purified recombinant Cas9 protein (PNA Bio, Inc., CP01-200) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... a mix of Synthego synthetized sgRNAs (final 250 ng/ul each) plus recombinant Cas9 protein (0.5ug/ul, PNA Bio) were injected using aluminosilicate glass needles (Sutter) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... recombinant Cas9 (CP02, PNA Bio) was added to a final concentration of 250 ng/μL ...
-
bioRxiv - Developmental Biology 2021Quote: dio2vp42rc1 and tbx6vp43rc1 mutant lines were produced by injecting in-vitro transcribed single guide RNAs and recombinant Cas9 protein (PNA Bio) as previously described (Saunders et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 2,000 wild-type Liverpool strain Aedes aegypti embryos were injected with a mix containing recombinant Cas9 protein (PNA Bio, CP01) at 300 ng/µL ...
-
bioRxiv - Developmental Biology 2022Quote: Each injection mix contained 250 ng/µl total of the purified gRNAs and 500 ng/µl of recombinant Cas9 protein (PNA Bio) with 0.2% phenol red in nuclease-free water ...
-
bioRxiv - Neuroscience 2022Quote: ... approximately 500 wild-type Aedes aegypti (Liverpool LVP-IB12 strain) embryos were injected with a mixture containing recombinant Cas9 protein (PNA Bio, CP01) at 300 ng/µl ...
-
bioRxiv - Cell Biology 2023Quote: ... Fertilized eggs of C57BL/6J mice were microinjected with recombinant Cas9 (PNA Bio) and guide RNAs (Synthego ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl of injection mixture consist of 1 µg of recombinant nls-Cas9 (PNA Bio), 200 ng of purified sgRNA ...
-
bioRxiv - Physiology 2023Quote: Recombinant Cas9 Nuclease and single guide RNA (sgRNA) were purchased from PNA Bio (Thousand Oaks, CA). Targeting oligonucleotide was obtained from IDT (Coralville ...
-
bioRxiv - Immunology 2020Quote: ... Cas9 protein (PNA bio) and gRNA were incubated at room temperature for 15 min in a 3:1 reaction with 15μg Cas9 and 5000 ng gRNA (2500ng of sgRNA#1 and 2500ng of sgRNA#2).47 The incubation product (gRNA and Cas9 complex ...
-
bioRxiv - Genetics 2021Quote: Cas9 protein (PNA Bio, Inc.) was mixed to a final concentration of 700 ng/ul with sgRNA (37.5 ng/ul ...
-
bioRxiv - Genetics 2022Quote: ... 750ng Cas9 protein (PNA Bio) and 375ng integration site gRNA were mixed ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cas9 protein (PNA Bio #CP01), phenol red ...
-
bioRxiv - Genetics 2023Quote: ... and Cas9 protein (PNA bio). A single gRNA with validated cleavage activity was chosen for incorporation into a synthetic gBlock (IDT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cas9 protein (PNA Bio CP02) at 50ng/µL ...
-
bioRxiv - Genetics 2022Quote: ... Cas9-NLS protein (PNA Bio) was added to the gRNA and incubated at room temperature for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA-protein complexes (RNPs) were prepared by mixing Cas9 protein 30-60 ug (PNA Bio) and 15-30 ug of gRNA per aliquot followed by incubation of 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... complexed with Cas9 protein (PNA Bio), and injected into 1-cell stage embryos ...
-
bioRxiv - Genomics 2024Quote: ... and purified Cas9 protein (PNA Bio) were obtained commercially ...
-
bioRxiv - Microbiology 2024Quote: ... 5µg of Cas9 protein (PNA Bio) and 2.5µg of each of the sgRNAs were incubated together for at least 10 minutes at room temperature before nucleofection of iPSC cells occurred using a Human Stem Cell Nucleofector Kit 2 (Lonza) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and 100 ng of which was used in cleavage assays with 300 ng of recombinant Cas9 (PNA BIO, Thousand Oaks, CA) and 100 ng of each guide RNA upon incubation at 37°C for 1 hour (Supplementary Fig ...
-
bioRxiv - Genetics 2020Quote: ... lyophilized Cas9 protein (PNA Bio Inc, CP01) was reconstituted to a stock concentration of 1 μg/μl in 20 mM Hepes ...
-
bioRxiv - Bioengineering 2020Quote: ... purified SpyCas9 protein 30 pmol (PNA Bio, #CP02 or 3xNLS-SpCas943(prepared by the Scot Wolfe laboratory ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cas9 protein was purchased from PNA Bio Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1μl Cas9 protein (1μg/uL, PNA BIO), 2μL 0.5% phenol red and 2μL dH2O were incubated at room temperature for 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Cas9 protein was purchased from PNA Bio, Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA was mixed with Cas9 Protein (PNA Bio) and Texas Red Dextran ...
-
bioRxiv - Developmental Biology 2022Quote: ... and CAS9 protein (500 ng/µL, PNA Bio) in HEPES buffer pH 7.5 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mg/mL Cas9 protein (PNA Bio CP02), a gRNA targeting tyr (GGACTGGAGGACTTCTGGGG ...
-
bioRxiv - Cell Biology 2024Quote: ... Cas9 protein was purchased from PNA Bio (#CP01). All repair templates and crRNA sequences used in this study are listed in Supplementary Table S3.
-
bioRxiv - Cell Biology 2024Quote: ... 30 µg/µl Cas9 protein (PNA Bio Inc), and 100 ng/µl ssODNs (IDT ...
-
bioRxiv - Genetics 2023Quote: ... The Cas9 protein was purchased from PNA Bio (CP01). All homozygous animals edited by CRISPR/Cas9 were validated by Sanger sequencing ...
-
bioRxiv - Bioengineering 2023Quote: ... The Cas9 protein powder was purchased from PNA BIO Inc ...