Labshake search
Citations for PNA Bio :
51 - 100 of 124 citations for Recombinant Human TNFRSF17 protein Fc His tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Cas9 protein was purchased from PNA Bio Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... Hybridization with 333ng/mL of a TelC-Cy5-labeled peptide nucleic acid (PNA) oligonucleotide telomere probe (N-CCTAACCTAACCTAA-C, PNA BIO) in PNA buffer (10mM Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Coverslips were dehydrated in an ethanol series (70%, 90% and 100%) and hybridized at RT with a TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio) in hybridization buffer (70% formamide ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA was mixed with Cas9 Protein (PNA Bio) and Texas Red Dextran ...
-
bioRxiv - Genomics 2019Quote: ... 10 ug Cas9 protein (PNA Bio CP01-20) was mixed with 10 ug modified guideRNA (Synthego ...
-
bioRxiv - Developmental Biology 2022Quote: ... and CAS9 protein (500 ng/µL, PNA Bio) in HEPES buffer pH 7.5 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cas9 protein with NLS (PNA Bio, CP01-200) was resuspended in 20% glycerol/water to a concentration of 1mg/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2018). Telomeric FISH was performed as previously described (Sfeir et al. 2009) using an Alexa488-labeled TelC PNA probe (PNA Bio Inc.). The cell cycle profiles of untreated vs ...
-
bioRxiv - Bioengineering 2023Quote: ... The Cas9 protein powder was purchased from PNA BIO Inc ...
-
bioRxiv - Genetics 2023Quote: ... The Cas9 protein was purchased from PNA Bio (CP01). All homozygous animals edited by CRISPR/Cas9 were validated by Sanger sequencing ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2400 ng Cas9 protein with NLS (PNA Bio CP01) were combined with 1200 ng of sgRNA in 4.5 μl nuclease-free water on the day of injection and left at room temperature for 10 minutes to form ribonucleoprotein complexes ...
-
bioRxiv - Developmental Biology 2019Quote: ... 200 pg/nl Cas9 protein (PNA Bio, Newbury Park, CA), or a combination of both reagents ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... sgRNAs were mixed with purified Cas9 protein (PNA Bio #CP01) with a final injected concentration of 0.05% phenol red to visualize the injection mix ...
-
bioRxiv - Bioengineering 2020Quote: ... 150ng of Cas9 protein (PNA Bio, Inc., Newbury Park, CA), 1μL of 10X BSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... but later studies utilized Cas9 protein (CP01, PNA BIO INC). When Cas9 protein was used we incubated the Cas9 protein/sgRNA mixture at 37°C for 5 minutes before injection ...
-
bioRxiv - Neuroscience 2023Quote: ... 60 pg sgRNA and 100 pg Cas9 protein (PNA Bio) were co-injected into one-cell stage wild-type embryos ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA1 and 50ng/μL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of zygotes positive for 3’ LoxP site ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA2 and 50ng/uL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of C57BL/6 zygotes ...
-
bioRxiv - Bioengineering 2020Quote: ... 167ng/μL of Cas9 protein (PNA Bio, Inc., Newbury Park, CA) and 133ng/μL of donor plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
bioRxiv - Developmental Biology 2021Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (Synthego)(Methods Appendix Fig ...
-
bioRxiv - Genetics 2019Quote: ... Purified Cas9 protein (400 ng/μl) (PNA Bio, Thousand Oaks, CA) and sgRNAs (100 ng/μl ...
-
bioRxiv - Developmental Biology 2022Quote: Injection mix containing Cas9 protein (PNA Bio; 100 ng/μl final concentration), sgRNA (80 ng/μL final concentration) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 protein was ordered from PNA Bio (CP01-50, Thousand Oaks, CA) and used to check cutting efficiency of the guides in vitro ...
-
bioRxiv - Molecular Biology 2020Quote: ... 500 ng/μl rCas9 protein (PNA Bio CP01-20 Thousand Oaks, California) and duplex buffer (IDT ...
-
Activity regulates a cell type-specific mitochondrial phenotype in zebrafish lateral line hair cellsbioRxiv - Cell Biology 2022Quote: ... Both guides were mixed with Cas9 protein (PNA Bio, Newbury Park, CA, USA) and simultaneously injected into embryos at the single-cell stage ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... the synthetized sgRNA was incubated with Cas9 protein (PNA Bio, Cat# CP02-250) to form an RNP complex ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified sgRNA (0.5 µg) was incubated with Cas9 protein (1 µg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Genetics 2022Quote: Wild type embryos were injected with 300 ng/ul Cas9 protein (PNA Bio), 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449) ...
-
bioRxiv - Genomics 2019Quote: ... They were then mixed with Cas9-NLS protein (PNA Bio, Newbury Park, CA, USA) and diluted to a final concentration of 125-250 ng/μl ...
-
bioRxiv - Neuroscience 2021Quote: ... the selected gRNA pair was mixed with SpCas9 protein (PNA Bio, Thousand Oaks, CA) along with a synthetic single-strand donor DNA oligo template as described above ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1200 ng gRNA were mixed with 2400 ng Cas9 protein with NLS (PNA Bio) in 5 μl nuclease-free water and incubated for 10 minutes at room temperature to form ribonucleoprotein (RNP ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A positive control Cas9 sample was made by diluting purified Cas9 protein (PNA Bio CP01) in homogenization buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... donor plasmid (700 ng/µL) and Cas9 protein (300 ng/µL, PNA Bio #CP01-200) was injected into 1533 Orlando strain embryos.
-
bioRxiv - Neuroscience 2021Quote: ... fertilized eggs were injected with precomplexed RNP (ribonucleoprotein)-Cas9 protein (PNA Bio, 50 ng/μl) and sgRNA (30 ng/μl) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and injected (300 ng/uL) along with Cas9 protein (PNA Bio Lab: CP01, 500 ng/uL) into embryos from the BDSC 25710 line (Bassett and Liu ...
-
bioRxiv - Cell Biology 2021Quote: ... was injected in one-cell stage embryos in a solution containing Nls-CAS9 protein (PNA BIO). The mutagenesis efficacy was evaluated on pools of 30 injected embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA (200 ng/µL) was co-microinjected with Cas9 protein (600 ng/µL; PNA Bio) into embryos at the one-cell stage ...
-
bioRxiv - Neuroscience 2020Quote: ... along with sgRNA (80 ng/μL) and Cas9 protein (300 ng/μL; PNA Bio, CP01-200). A total of 1500 ORL embryos were injected at the Insect Transformation Facility at the University of Maryland Institute for BioScience & Biotechnology ...
-
bioRxiv - Developmental Biology 2020Quote: ... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
bioRxiv - Molecular Biology 2023Quote: ... the LoxP1 site was inserted by electroporation of 12,2 uM RNP Cas9 protein (PNA BIO, #CP02), 16 uM sgRNA1 and 4,8 uM ssODN (LoxP1 sequence ...
-
bioRxiv - Developmental Biology 2019Quote: ... One nL of injection cocktail (100 pg/nl gRNA and 200 pg/nl Cas9 protein (PNA Bio) in water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2nL of a mixture containing 50pg/nl sgRNA with 0.5ng/nl Cas9 protein (PNA Bio CP01-20) was injected on either side of the sperm entry point at the 1-cell stage (total of 200pg sgRNA and 2ng Cas9 protein per embryo).
-
bioRxiv - Immunology 2020Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio, Newbury Park, CA, USA) for 10 min at room temperature ...
-
bioRxiv - Systems Biology 2023Quote: ... 125 ng of each gRNA was separately incubated with 250 ng of Cas9 protein (PNA Bio Inc) for 10 minutes at room temp ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The injection master mix also included preassembled RNP complex of Cas9 protein (200 ng/ml) (PNA Bio)33 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
bioRxiv - Immunology 2023Quote: ... An injection mix containing 75 ng/μL of each gRNA and 250 ng/μL Cas9 protein (PNA Bio) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... each targeting a different gene (80 ng/uL each) with Cas9 protein (300 ng/µL; PNA Bio, CP01-200) and injected into ORL embryos ...