Labshake search
Citations for PNA Bio :
51 - 100 of 112 citations for Recombinant Human S100 Calcium Binding Protein A9 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... sgRNAs were mixed with purified Cas9 protein (PNA Bio #CP01) with a final injected concentration of 0.05% phenol red to visualize the injection mix ...
-
bioRxiv - Bioengineering 2020Quote: ... 150ng of Cas9 protein (PNA Bio, Inc., Newbury Park, CA), 1μL of 10X BSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... but later studies utilized Cas9 protein (CP01, PNA BIO INC). When Cas9 protein was used we incubated the Cas9 protein/sgRNA mixture at 37°C for 5 minutes before injection ...
-
bioRxiv - Neuroscience 2023Quote: ... 60 pg sgRNA and 100 pg Cas9 protein (PNA Bio) were co-injected into one-cell stage wild-type embryos ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA2 and 50ng/uL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of C57BL/6 zygotes ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA1 and 50ng/μL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of zygotes positive for 3’ LoxP site ...
-
bioRxiv - Bioengineering 2020Quote: ... 167ng/μL of Cas9 protein (PNA Bio, Inc., Newbury Park, CA) and 133ng/μL of donor plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
bioRxiv - Developmental Biology 2021Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (Synthego)(Methods Appendix Fig ...
-
bioRxiv - Genetics 2019Quote: ... Purified Cas9 protein (400 ng/μl) (PNA Bio, Thousand Oaks, CA) and sgRNAs (100 ng/μl ...
-
bioRxiv - Developmental Biology 2022Quote: Injection mix containing Cas9 protein (PNA Bio; 100 ng/μl final concentration), sgRNA (80 ng/μL final concentration) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 protein was ordered from PNA Bio (CP01-50, Thousand Oaks, CA) and used to check cutting efficiency of the guides in vitro ...
-
bioRxiv - Molecular Biology 2020Quote: ... 500 ng/μl rCas9 protein (PNA Bio CP01-20 Thousand Oaks, California) and duplex buffer (IDT ...
-
Activity regulates a cell type-specific mitochondrial phenotype in zebrafish lateral line hair cellsbioRxiv - Cell Biology 2022Quote: ... Both guides were mixed with Cas9 protein (PNA Bio, Newbury Park, CA, USA) and simultaneously injected into embryos at the single-cell stage ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... the synthetized sgRNA was incubated with Cas9 protein (PNA Bio, Cat# CP02-250) to form an RNP complex ...
-
bioRxiv - Genetics 2022Quote: Wild type embryos were injected with 300 ng/ul Cas9 protein (PNA Bio), 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified sgRNA (0.5 µg) was incubated with Cas9 protein (1 µg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... They were then mixed with Cas9-NLS protein (PNA Bio, Newbury Park, CA, USA) and diluted to a final concentration of 125-250 ng/μl ...
-
bioRxiv - Neuroscience 2021Quote: ... the selected gRNA pair was mixed with SpCas9 protein (PNA Bio, Thousand Oaks, CA) along with a synthetic single-strand donor DNA oligo template as described above ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1200 ng gRNA were mixed with 2400 ng Cas9 protein with NLS (PNA Bio) in 5 μl nuclease-free water and incubated for 10 minutes at room temperature to form ribonucleoprotein (RNP ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A positive control Cas9 sample was made by diluting purified Cas9 protein (PNA Bio CP01) in homogenization buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... donor plasmid (700 ng/µL) and Cas9 protein (300 ng/µL, PNA Bio #CP01-200) was injected into 1533 Orlando strain embryos.
-
bioRxiv - Neuroscience 2021Quote: ... fertilized eggs were injected with precomplexed RNP (ribonucleoprotein)-Cas9 protein (PNA Bio, 50 ng/μl) and sgRNA (30 ng/μl) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and injected (300 ng/uL) along with Cas9 protein (PNA Bio Lab: CP01, 500 ng/uL) into embryos from the BDSC 25710 line (Bassett and Liu ...
-
bioRxiv - Cell Biology 2021Quote: ... was injected in one-cell stage embryos in a solution containing Nls-CAS9 protein (PNA BIO). The mutagenesis efficacy was evaluated on pools of 30 injected embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA (200 ng/µL) was co-microinjected with Cas9 protein (600 ng/µL; PNA Bio) into embryos at the one-cell stage ...
-
bioRxiv - Neuroscience 2020Quote: ... along with sgRNA (80 ng/μL) and Cas9 protein (300 ng/μL; PNA Bio, CP01-200). A total of 1500 ORL embryos were injected at the Insect Transformation Facility at the University of Maryland Institute for BioScience & Biotechnology ...
-
bioRxiv - Developmental Biology 2020Quote: ... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
bioRxiv - Molecular Biology 2023Quote: ... the LoxP1 site was inserted by electroporation of 12,2 uM RNP Cas9 protein (PNA BIO, #CP02), 16 uM sgRNA1 and 4,8 uM ssODN (LoxP1 sequence ...
-
bioRxiv - Developmental Biology 2019Quote: ... One nL of injection cocktail (100 pg/nl gRNA and 200 pg/nl Cas9 protein (PNA Bio) in water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2nL of a mixture containing 50pg/nl sgRNA with 0.5ng/nl Cas9 protein (PNA Bio CP01-20) was injected on either side of the sperm entry point at the 1-cell stage (total of 200pg sgRNA and 2ng Cas9 protein per embryo).
-
bioRxiv - Immunology 2020Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio, Newbury Park, CA, USA) for 10 min at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The injection master mix also included preassembled RNP complex of Cas9 protein (200 ng/ml) (PNA Bio)33 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
bioRxiv - Systems Biology 2023Quote: ... 125 ng of each gRNA was separately incubated with 250 ng of Cas9 protein (PNA Bio Inc) for 10 minutes at room temp ...
-
bioRxiv - Immunology 2023Quote: ... An injection mix containing 75 ng/μL of each gRNA and 250 ng/μL Cas9 protein (PNA Bio) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... each targeting a different gene (80 ng/uL each) with Cas9 protein (300 ng/µL; PNA Bio, CP01-200) and injected into ORL embryos ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 10 g of each sgRNA (#1 and #2 modified sgRNAs, Synthego) and 15 g Cas9 protein (PNA Bio) and were electroporated using program A23 on the Nucleofector™ 2b Device (Lonza) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used a non-homologous end joining mediated strategy by injecting the mixture of Cas9 protein (#CP01; PNA Bio) and sgRNAs into the embryos of this species ...
-
bioRxiv - Developmental Biology 2021Quote: ... or with 5 nl or 10 nl of 75pg/nl of sgRNA mixed with 0.2 ng/nl of Cas9 protein (PNA Bio) and 0.1% Texas Red Dextran in 1 cell of 2-cell stage embryos ...
-
bioRxiv - Cell Biology 2022Quote: ... 80 pg of sgRNA was co-injected with 200 pg of Cas9 protein (#CP01-50; PNA Bio, Newbury Park, CA) into 1-cell zebrafish embryos ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of annealed RNAs was incubated with 1 µL of 10 mg/mL Cas9 protein (PNA Bio # CP01-200) at room temperature (22°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1.65µL of each of two lmn-1 crRNA per strain (30pmol/µl) was combined and added to 1µL of purified Cas9 protein (5µg/µl from PNA Bio, Inc). Following addition of 1µL of the dpy-10 ssODN (500ng/µL ...
-
bioRxiv - Developmental Biology 2021Quote: Mutants were generated by injecting one-cell stage embryos with 200 ng/ml sgRNAs and 500 ng/ml Cas9 protein (PNA Bio) using standard procedures (Shah et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... mutations we used CRISPR/Cas9 mutagenesis by injecting 1-cell stage embryos with 200 ng/μl T7 sgRNA and 500 ng/μl Cas9 protein (PNA Bio) as described (Shah et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... esrp2 and irf6 CRISPR sgRNAs were generated by in vitro transcription from a SP6 promoter as described.(Gagnon et al., 2014) Lyophilized Cas9 protein (PNA Bio) was resuspended in ddH2O to a stock concentration of 1 μg/μl and stored in single-use aliquots in −80°C to avoid freeze-thaw inactivation and kept for 6 months ...
-
bioRxiv - Developmental Biology 2022Quote: ... In vitro transcribed guide RNAs were made from PCR-generated templates (Bhattacharya et al. 2015) and were complexed with Cas9 protein (CP01; PNA Bio) at 37°C before injection into the animal pole of fertilised eggs at the 1-2 cell stage ...
-
bioRxiv - Genetics 2020Quote: ... An injection mix was made with 40 ng/ul sgRNA RNA and 300 ng/ul Cas9 protein (PNA Bio # CP01-50) and injected into embryos from our BDC stock (Fig ...
-
bioRxiv - Neuroscience 2022Quote: ... embryos at the very early 1 cell stage were injected with 374.5 ng/μl of the guide RNA targeted to zebrafish klc4 complexed with 800 ng/μl of Cas9 protein with NLS (PNA Bio). Injection volume was approximately 1nL ...