Labshake search
Citations for PNA Bio :
51 - 100 of 110 citations for Recombinant Human GDF11 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 60 pg sgRNA and 100 pg Cas9 protein (PNA Bio) were co-injected into one-cell stage wild-type embryos ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA2 and 50ng/uL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of C57BL/6 zygotes ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA1 and 50ng/μL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of zygotes positive for 3’ LoxP site ...
-
bioRxiv - Bioengineering 2020Quote: ... 167ng/μL of Cas9 protein (PNA Bio, Inc., Newbury Park, CA) and 133ng/μL of donor plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
bioRxiv - Developmental Biology 2021Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (Synthego)(Methods Appendix Fig ...
-
bioRxiv - Genetics 2019Quote: ... Purified Cas9 protein (400 ng/μl) (PNA Bio, Thousand Oaks, CA) and sgRNAs (100 ng/μl ...
-
bioRxiv - Developmental Biology 2022Quote: Injection mix containing Cas9 protein (PNA Bio; 100 ng/μl final concentration), sgRNA (80 ng/μL final concentration) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 protein was ordered from PNA Bio (CP01-50, Thousand Oaks, CA) and used to check cutting efficiency of the guides in vitro ...
-
bioRxiv - Molecular Biology 2020Quote: ... 500 ng/μl rCas9 protein (PNA Bio CP01-20 Thousand Oaks, California) and duplex buffer (IDT ...
-
Activity regulates a cell type-specific mitochondrial phenotype in zebrafish lateral line hair cellsbioRxiv - Cell Biology 2022Quote: ... Both guides were mixed with Cas9 protein (PNA Bio, Newbury Park, CA, USA) and simultaneously injected into embryos at the single-cell stage ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... the synthetized sgRNA was incubated with Cas9 protein (PNA Bio, Cat# CP02-250) to form an RNP complex ...
-
bioRxiv - Genetics 2022Quote: Wild type embryos were injected with 300 ng/ul Cas9 protein (PNA Bio), 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified sgRNA (0.5 µg) was incubated with Cas9 protein (1 µg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... They were then mixed with Cas9-NLS protein (PNA Bio, Newbury Park, CA, USA) and diluted to a final concentration of 125-250 ng/μl ...
-
bioRxiv - Neuroscience 2021Quote: ... the selected gRNA pair was mixed with SpCas9 protein (PNA Bio, Thousand Oaks, CA) along with a synthetic single-strand donor DNA oligo template as described above ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1200 ng gRNA were mixed with 2400 ng Cas9 protein with NLS (PNA Bio) in 5 μl nuclease-free water and incubated for 10 minutes at room temperature to form ribonucleoprotein (RNP ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A positive control Cas9 sample was made by diluting purified Cas9 protein (PNA Bio CP01) in homogenization buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... donor plasmid (700 ng/µL) and Cas9 protein (300 ng/µL, PNA Bio #CP01-200) was injected into 1533 Orlando strain embryos.
-
bioRxiv - Neuroscience 2021Quote: ... fertilized eggs were injected with precomplexed RNP (ribonucleoprotein)-Cas9 protein (PNA Bio, 50 ng/μl) and sgRNA (30 ng/μl) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and injected (300 ng/uL) along with Cas9 protein (PNA Bio Lab: CP01, 500 ng/uL) into embryos from the BDSC 25710 line (Bassett and Liu ...
-
bioRxiv - Cell Biology 2021Quote: ... was injected in one-cell stage embryos in a solution containing Nls-CAS9 protein (PNA BIO). The mutagenesis efficacy was evaluated on pools of 30 injected embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA (200 ng/µL) was co-microinjected with Cas9 protein (600 ng/µL; PNA Bio) into embryos at the one-cell stage ...
-
bioRxiv - Neuroscience 2020Quote: ... along with sgRNA (80 ng/μL) and Cas9 protein (300 ng/μL; PNA Bio, CP01-200). A total of 1500 ORL embryos were injected at the Insect Transformation Facility at the University of Maryland Institute for BioScience & Biotechnology ...
-
bioRxiv - Developmental Biology 2020Quote: ... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
bioRxiv - Molecular Biology 2023Quote: ... the LoxP1 site was inserted by electroporation of 12,2 uM RNP Cas9 protein (PNA BIO, #CP02), 16 uM sgRNA1 and 4,8 uM ssODN (LoxP1 sequence ...
-
bioRxiv - Developmental Biology 2019Quote: ... One nL of injection cocktail (100 pg/nl gRNA and 200 pg/nl Cas9 protein (PNA Bio) in water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2nL of a mixture containing 50pg/nl sgRNA with 0.5ng/nl Cas9 protein (PNA Bio CP01-20) was injected on either side of the sperm entry point at the 1-cell stage (total of 200pg sgRNA and 2ng Cas9 protein per embryo).
-
bioRxiv - Immunology 2020Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio, Newbury Park, CA, USA) for 10 min at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The injection master mix also included preassembled RNP complex of Cas9 protein (200 ng/ml) (PNA Bio)33 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
bioRxiv - Systems Biology 2023Quote: ... 125 ng of each gRNA was separately incubated with 250 ng of Cas9 protein (PNA Bio Inc) for 10 minutes at room temp ...
-
bioRxiv - Immunology 2023Quote: ... An injection mix containing 75 ng/μL of each gRNA and 250 ng/μL Cas9 protein (PNA Bio) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... each targeting a different gene (80 ng/uL each) with Cas9 protein (300 ng/µL; PNA Bio, CP01-200) and injected into ORL embryos ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 10 g of each sgRNA (#1 and #2 modified sgRNAs, Synthego) and 15 g Cas9 protein (PNA Bio) and were electroporated using program A23 on the Nucleofector™ 2b Device (Lonza) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used a non-homologous end joining mediated strategy by injecting the mixture of Cas9 protein (#CP01; PNA Bio) and sgRNAs into the embryos of this species ...
-
bioRxiv - Developmental Biology 2021Quote: ... or with 5 nl or 10 nl of 75pg/nl of sgRNA mixed with 0.2 ng/nl of Cas9 protein (PNA Bio) and 0.1% Texas Red Dextran in 1 cell of 2-cell stage embryos ...
-
bioRxiv - Cell Biology 2022Quote: ... 80 pg of sgRNA was co-injected with 200 pg of Cas9 protein (#CP01-50; PNA Bio, Newbury Park, CA) into 1-cell zebrafish embryos ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of annealed RNAs was incubated with 1 µL of 10 mg/mL Cas9 protein (PNA Bio # CP01-200) at room temperature (22°C ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1.65µL of each of two lmn-1 crRNA per strain (30pmol/µl) was combined and added to 1µL of purified Cas9 protein (5µg/µl from PNA Bio, Inc). Following addition of 1µL of the dpy-10 ssODN (500ng/µL ...
-
bioRxiv - Developmental Biology 2021Quote: Mutants were generated by injecting one-cell stage embryos with 200 ng/ml sgRNAs and 500 ng/ml Cas9 protein (PNA Bio) using standard procedures (Shah et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... mutations we used CRISPR/Cas9 mutagenesis by injecting 1-cell stage embryos with 200 ng/μl T7 sgRNA and 500 ng/μl Cas9 protein (PNA Bio) as described (Shah et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... esrp2 and irf6 CRISPR sgRNAs were generated by in vitro transcription from a SP6 promoter as described.(Gagnon et al., 2014) Lyophilized Cas9 protein (PNA Bio) was resuspended in ddH2O to a stock concentration of 1 μg/μl and stored in single-use aliquots in −80°C to avoid freeze-thaw inactivation and kept for 6 months ...
-
bioRxiv - Developmental Biology 2022Quote: ... In vitro transcribed guide RNAs were made from PCR-generated templates (Bhattacharya et al. 2015) and were complexed with Cas9 protein (CP01; PNA Bio) at 37°C before injection into the animal pole of fertilised eggs at the 1-2 cell stage ...
-
bioRxiv - Genetics 2020Quote: ... An injection mix was made with 40 ng/ul sgRNA RNA and 300 ng/ul Cas9 protein (PNA Bio # CP01-50) and injected into embryos from our BDC stock (Fig ...
-
bioRxiv - Neuroscience 2022Quote: ... embryos at the very early 1 cell stage were injected with 374.5 ng/μl of the guide RNA targeted to zebrafish klc4 complexed with 800 ng/μl of Cas9 protein with NLS (PNA Bio). Injection volume was approximately 1nL ...
-
bioRxiv - Developmental Biology 2021Quote: ... we injected a mixture of guide RNA (200pg/nl total final concentration) and Cas9 protein (PNA Bio; 400 pg/nl final concentration) into one-cell stage AB embryos ...
-
bioRxiv - Cell Biology 2023Quote: ... CD33 chemically modified guide RNAs (6.25 μg/106 cells, Synthego, Redwood City, CA) and Cas9 protein (12.5 μg/106 cells, PNA Bio, Thousand Oaks, CA) were mixed for 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Fertilised eggs from C57BL/6J mice were injected with the two gRNAs (Msh3 gRNA 51/57 and Msh3 gRNA 89/69) and Cas9 protein (PNA BIO INC) and transferred to pseudopregnant CD1 female mice ...