Labshake search
Citations for PNA Bio :
1 - 50 of 115 citations for Rat Oxidation resistance protein 1 Oxr1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant Cas9 protein (900 ng μl−1; PNA Bio, #CP01-20) was co-injected with both sgRNAs (20μM each ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified sgRNA (0.5 µg) was incubated with Cas9 protein (1 µg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of annealed RNAs was incubated with 1 µL of 10 mg/mL Cas9 protein (PNA Bio # CP01-200) at room temperature (22°C ...
-
bioRxiv - Neuroscience 2022Quote: ... USA) and 1μl recombinant Cas9 protein (1 μg/μl, PNA Bio, Thousand Oaks, CA, USA) and 2μl RNAse-free water ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... It includes the Recombinant Cas9 protein with NLS sequence (1500 ng /μl−1; PNA Bio, CP0120) and the sgRNA (750 ng/ μl−1) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Injection solutions consisted of combinations of: 1 μg/μl Cas9 recombinant protein (PNA Bio, CP-01) or 400 ng/μl Cas9 mRNA (Addgene plasmid #51307 (Guo et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
bioRxiv - Immunology 2020Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio, Newbury Park, CA, USA) for 10 min at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... Cas9 protein (PNA bio) and gRNA were incubated at room temperature for 15 min in a 3:1 reaction with 15μg Cas9 and 5000 ng gRNA (2500ng of sgRNA#1 and 2500ng of sgRNA#2).47 The incubation product (gRNA and Cas9 complex ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant Cas9 protein (PNA Bio) and sgRNAs were injected at concentrations of 400 ng/µl of Cas9 protein and 100 ng/µl for each sgRNA ...
-
bioRxiv - Genetics 2021Quote: Cas9 protein (PNA Bio, Inc.) was mixed to a final concentration of 700 ng/ul with sgRNA (37.5 ng/ul ...
-
bioRxiv - Genetics 2022Quote: ... 750ng Cas9 protein (PNA Bio) and 375ng integration site gRNA were mixed ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cas9 protein (PNA Bio #CP01), phenol red ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cas9 protein (PNA Bio CP02) at 50ng/µL ...
-
bioRxiv - Genetics 2023Quote: ... and Cas9 protein (PNA bio). A single gRNA with validated cleavage activity was chosen for incorporation into a synthetic gBlock (IDT ...
-
bioRxiv - Genetics 2022Quote: ... Cas9-NLS protein (PNA Bio) was added to the gRNA and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 10 g of each sgRNA (#1 and #2 modified sgRNAs, Synthego) and 15 g Cas9 protein (PNA Bio) and were electroporated using program A23 on the Nucleofector™ 2b Device (Lonza) ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA-protein complexes (RNPs) were prepared by mixing Cas9 protein 30-60 ug (PNA Bio) and 15-30 ug of gRNA per aliquot followed by incubation of 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... complexed with Cas9 protein (PNA Bio), and injected into 1-cell stage embryos ...
-
bioRxiv - Developmental Biology 2021Quote: ... mutations we used CRISPR/Cas9 mutagenesis by injecting 1-cell stage embryos with 200 ng/μl T7 sgRNA and 500 ng/μl Cas9 protein (PNA Bio) as described (Shah et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... the protein Cas9 (recombinant cas protein from S. pyogenes PNA Bio CP01, final concentration 100 ng/μL) and KCL (final concentration 200 mM) ...
-
bioRxiv - Genetics 2020Quote: ... lyophilized Cas9 protein (PNA Bio Inc, CP01) was reconstituted to a stock concentration of 1 μg/μl in 20 mM Hepes ...
-
bioRxiv - Bioengineering 2020Quote: ... purified SpyCas9 protein 30 pmol (PNA Bio, #CP02 or 3xNLS-SpCas943(prepared by the Scot Wolfe laboratory ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cas9 protein was purchased from PNA Bio Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... purified recombinant Cas9 protein (PNA Bio, 300ng/ul) and donor plasmid (500ng/ul ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA was mixed with Cas9 Protein (PNA Bio) and Texas Red Dextran ...
-
bioRxiv - Genomics 2019Quote: ... 10 ug Cas9 protein (PNA Bio CP01-20) was mixed with 10 ug modified guideRNA (Synthego ...
-
bioRxiv - Developmental Biology 2022Quote: ... and CAS9 protein (500 ng/µL, PNA Bio) in HEPES buffer pH 7.5 (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cas9 protein with NLS (PNA Bio, CP01-200) was resuspended in 20% glycerol/water to a concentration of 1mg/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... The Cas9 protein powder was purchased from PNA BIO Inc ...
-
bioRxiv - Genetics 2023Quote: ... The Cas9 protein was purchased from PNA Bio (CP01). All homozygous animals edited by CRISPR/Cas9 were validated by Sanger sequencing ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2400 ng Cas9 protein with NLS (PNA Bio CP01) were combined with 1200 ng of sgRNA in 4.5 μl nuclease-free water on the day of injection and left at room temperature for 10 minutes to form ribonucleoprotein complexes ...
-
bioRxiv - Developmental Biology 2019Quote: ... 200 pg/nl Cas9 protein (PNA Bio, Newbury Park, CA), or a combination of both reagents ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... sgRNAs were mixed with purified Cas9 protein (PNA Bio #CP01) with a final injected concentration of 0.05% phenol red to visualize the injection mix ...
-
bioRxiv - Bioengineering 2020Quote: ... 150ng of Cas9 protein (PNA Bio, Inc., Newbury Park, CA), 1μL of 10X BSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... but later studies utilized Cas9 protein (CP01, PNA BIO INC). When Cas9 protein was used we incubated the Cas9 protein/sgRNA mixture at 37°C for 5 minutes before injection ...
-
bioRxiv - Neuroscience 2023Quote: ... 60 pg sgRNA and 100 pg Cas9 protein (PNA Bio) were co-injected into one-cell stage wild-type embryos ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA1 and 50ng/μL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of zygotes positive for 3’ LoxP site ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA2 and 50ng/uL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of C57BL/6 zygotes ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant Cas9 protein containing a nuclear localization signal (PNA Bio Inc) was reconstituted to a solution of 1 mg/mL Cas9 protein in 20 mM HEPES ...
-
bioRxiv - Bioengineering 2020Quote: ... 167ng/μL of Cas9 protein (PNA Bio, Inc., Newbury Park, CA) and 133ng/μL of donor plasmid ...
-
bioRxiv - Developmental Biology 2022Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
bioRxiv - Developmental Biology 2021Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (Synthego)(Methods Appendix Fig ...
-
bioRxiv - Genetics 2019Quote: ... Purified Cas9 protein (400 ng/μl) (PNA Bio, Thousand Oaks, CA) and sgRNAs (100 ng/μl ...
-
bioRxiv - Bioengineering 2019Quote: ... Synthetic gRNAs (Synthego) and recombinant Streptococcus pyogenes Cas9 protein (PNA Bio Inc.) were obtained commercially and diluted to 1,000 ng/µL in nuclease-free water and stored in aliquots at –80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... before adding recombinant Cas9 protein (300 ng/µL; PNA Bio, CP01-200) for embryo injection.
-
bioRxiv - Developmental Biology 2022Quote: Injection mix containing Cas9 protein (PNA Bio; 100 ng/μl final concentration), sgRNA (80 ng/μL final concentration) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 protein was ordered from PNA Bio (CP01-50, Thousand Oaks, CA) and used to check cutting efficiency of the guides in vitro ...
-
bioRxiv - Molecular Biology 2020Quote: ... 500 ng/μl rCas9 protein (PNA Bio CP01-20 Thousand Oaks, California) and duplex buffer (IDT ...