Labshake search
Citations for PNA Bio :
51 - 100 of 106 citations for Zika Virus NS1 Proteins Uganda Suriname Strains Duo Pack since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: Wild type embryos were injected with 300 ng/ul Cas9 protein (PNA Bio), 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified sgRNA (0.5 µg) was incubated with Cas9 protein (1 µg, PNA Bio) for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Cas9 recombinant protein with nuclear localization signal (260 ng/μl; PNA Bio, USA) was co-injected with the gRNA (140ng/µl ...
-
bioRxiv - Genomics 2019Quote: ... They were then mixed with Cas9-NLS protein (PNA Bio, Newbury Park, CA, USA) and diluted to a final concentration of 125-250 ng/μl ...
-
bioRxiv - Neuroscience 2021Quote: ... the selected gRNA pair was mixed with SpCas9 protein (PNA Bio, Thousand Oaks, CA) along with a synthetic single-strand donor DNA oligo template as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... The CRISPR injection mixture contained 300 ng/µl recombinant Cas9 protein (PNA Bio CP01) and 40 ng/ µl sgRNA (per guide ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 μg of purified recombinant SpCas9 protein (PNA Bio, Inc., Thousand Oaks, CA, USA) was pre-complexed on ice for 20 min with 10 μg of the chemically modified sgRNA (bearing 2’-O methyl phosphorothioate- modified nucleotides at the first 3 and last 3 positions of the synthetic sgRNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1200 ng gRNA were mixed with 2400 ng Cas9 protein with NLS (PNA Bio) in 5 μl nuclease-free water and incubated for 10 minutes at room temperature to form ribonucleoprotein (RNP ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... A positive control Cas9 sample was made by diluting purified Cas9 protein (PNA Bio CP01) in homogenization buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... donor plasmid (700 ng/µL) and Cas9 protein (300 ng/µL, PNA Bio #CP01-200) was injected into 1533 Orlando strain embryos.
-
bioRxiv - Neuroscience 2022Quote: ... USA) and 1μl recombinant Cas9 protein (1 μg/μl, PNA Bio, Thousand Oaks, CA, USA) and 2μl RNAse-free water ...
-
bioRxiv - Neuroscience 2021Quote: ... fertilized eggs were injected with precomplexed RNP (ribonucleoprotein)-Cas9 protein (PNA Bio, 50 ng/μl) and sgRNA (30 ng/μl) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and injected (300 ng/uL) along with Cas9 protein (PNA Bio Lab: CP01, 500 ng/uL) into embryos from the BDSC 25710 line (Bassett and Liu ...
-
bioRxiv - Cell Biology 2021Quote: ... was injected in one-cell stage embryos in a solution containing Nls-CAS9 protein (PNA BIO). The mutagenesis efficacy was evaluated on pools of 30 injected embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA (200 ng/µL) was co-microinjected with Cas9 protein (600 ng/µL; PNA Bio) into embryos at the one-cell stage ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... It includes the Recombinant Cas9 protein with NLS sequence (1500 ng /μl−1; PNA Bio, CP0120) and the sgRNA (750 ng/ μl−1) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Injection solutions consisted of combinations of: 1 μg/μl Cas9 recombinant protein (PNA Bio, CP-01) or 400 ng/μl Cas9 mRNA (Addgene plasmid #51307 (Guo et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... along with sgRNA (80 ng/μL) and Cas9 protein (300 ng/μL; PNA Bio, CP01-200). A total of 1500 ORL embryos were injected at the Insect Transformation Facility at the University of Maryland Institute for BioScience & Biotechnology ...
-
bioRxiv - Developmental Biology 2020Quote: ... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
bioRxiv - Molecular Biology 2023Quote: ... the LoxP1 site was inserted by electroporation of 12,2 uM RNP Cas9 protein (PNA BIO, #CP02), 16 uM sgRNA1 and 4,8 uM ssODN (LoxP1 sequence ...
-
bioRxiv - Developmental Biology 2019Quote: ... One nL of injection cocktail (100 pg/nl gRNA and 200 pg/nl Cas9 protein (PNA Bio) in water ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2nL of a mixture containing 50pg/nl sgRNA with 0.5ng/nl Cas9 protein (PNA Bio CP01-20) was injected on either side of the sperm entry point at the 1-cell stage (total of 200pg sgRNA and 2ng Cas9 protein per embryo).
-
bioRxiv - Genetics 2021Quote: ... ubi:delta-EGFP was generated by injecting in vitro-transcribed sg RNA and recombinant Cas9 protein (PNA Bio) into ubi:Switch zygotes (Burger et al. ...
-
bioRxiv - Immunology 2020Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio, Newbury Park, CA, USA) for 10 min at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The injection master mix also included preassembled RNP complex of Cas9 protein (200 ng/ml) (PNA Bio)33 ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
bioRxiv - Systems Biology 2023Quote: ... 125 ng of each gRNA was separately incubated with 250 ng of Cas9 protein (PNA Bio Inc) for 10 minutes at room temp ...
-
bioRxiv - Immunology 2023Quote: ... An injection mix containing 75 ng/μL of each gRNA and 250 ng/μL Cas9 protein (PNA Bio) was used ...
-
bioRxiv - Neuroscience 2020Quote: ... each targeting a different gene (80 ng/uL each) with Cas9 protein (300 ng/µL; PNA Bio, CP01-200) and injected into ORL embryos ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 10 g of each sgRNA (#1 and #2 modified sgRNAs, Synthego) and 15 g Cas9 protein (PNA Bio) and were electroporated using program A23 on the Nucleofector™ 2b Device (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... sgRNA activity was confirmed by in vitro cleavage assays with purified recombinant Cas9 protein (PNA Bio, Inc., CP01-200) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used a non-homologous end joining mediated strategy by injecting the mixture of Cas9 protein (#CP01; PNA Bio) and sgRNAs into the embryos of this species ...
-
bioRxiv - Developmental Biology 2021Quote: ... or with 5 nl or 10 nl of 75pg/nl of sgRNA mixed with 0.2 ng/nl of Cas9 protein (PNA Bio) and 0.1% Texas Red Dextran in 1 cell of 2-cell stage embryos ...
-
bioRxiv - Cell Biology 2022Quote: ... 80 pg of sgRNA was co-injected with 200 pg of Cas9 protein (#CP01-50; PNA Bio, Newbury Park, CA) into 1-cell zebrafish embryos ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of annealed RNAs was incubated with 1 µL of 10 mg/mL Cas9 protein (PNA Bio # CP01-200) at room temperature (22°C ...
-
bioRxiv - Developmental Biology 2021Quote: Mutants were generated by injecting one-cell stage embryos with 200 ng/ml sgRNAs and 500 ng/ml Cas9 protein (PNA Bio) using standard procedures (Shah et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... mutations we used CRISPR/Cas9 mutagenesis by injecting 1-cell stage embryos with 200 ng/μl T7 sgRNA and 500 ng/μl Cas9 protein (PNA Bio) as described (Shah et al. ...
-
bioRxiv - Developmental Biology 2021Quote: dio2vp42rc1 and tbx6vp43rc1 mutant lines were produced by injecting in-vitro transcribed single guide RNAs and recombinant Cas9 protein (PNA Bio) as previously described (Saunders et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... esrp2 and irf6 CRISPR sgRNAs were generated by in vitro transcription from a SP6 promoter as described.(Gagnon et al., 2014) Lyophilized Cas9 protein (PNA Bio) was resuspended in ddH2O to a stock concentration of 1 μg/μl and stored in single-use aliquots in −80°C to avoid freeze-thaw inactivation and kept for 6 months ...
-
bioRxiv - Developmental Biology 2022Quote: ... In vitro transcribed guide RNAs were made from PCR-generated templates (Bhattacharya et al. 2015) and were complexed with Cas9 protein (CP01; PNA Bio) at 37°C before injection into the animal pole of fertilised eggs at the 1-2 cell stage ...
-
bioRxiv - Developmental Biology 2022Quote: Each injection mix contained 250 ng/µl total of the purified gRNAs and 500 ng/µl of recombinant Cas9 protein (PNA Bio) with 0.2% phenol red in nuclease-free water ...
-
bioRxiv - Genetics 2020Quote: ... An injection mix was made with 40 ng/ul sgRNA RNA and 300 ng/ul Cas9 protein (PNA Bio # CP01-50) and injected into embryos from our BDC stock (Fig ...
-
bioRxiv - Neuroscience 2022Quote: ... embryos at the very early 1 cell stage were injected with 374.5 ng/μl of the guide RNA targeted to zebrafish klc4 complexed with 800 ng/μl of Cas9 protein with NLS (PNA Bio). Injection volume was approximately 1nL ...
-
bioRxiv - Developmental Biology 2021Quote: ... we injected a mixture of guide RNA (200pg/nl total final concentration) and Cas9 protein (PNA Bio; 400 pg/nl final concentration) into one-cell stage AB embryos ...
-
bioRxiv - Cell Biology 2023Quote: ... CD33 chemically modified guide RNAs (6.25 μg/106 cells, Synthego, Redwood City, CA) and Cas9 protein (12.5 μg/106 cells, PNA Bio, Thousand Oaks, CA) were mixed for 10 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Fertilised eggs from C57BL/6J mice were injected with the two gRNAs (Msh3 gRNA 51/57 and Msh3 gRNA 89/69) and Cas9 protein (PNA BIO INC) and transferred to pseudopregnant CD1 female mice ...
-
bioRxiv - Developmental Biology 2021Quote: ... dsDNA or ssDNA PCR donors (final concentration 5-10 pg/nL) Cas9 protein tagged with a nuclear localization sequence (PNA Bio CP-01) (final concentration 300-500 pg/nL) ...
-
bioRxiv - Developmental Biology 2021Quote: A mixture of the pooled guide RNA cocktail (400pg/μl total final concentration) and Cas9 protein (PNA Bio; 200 pg/μl final concentration) was injected into one-cell stage AB embryos ...
-
bioRxiv - Neuroscience 2022Quote: ... Wild type embryos of the Aedes aegypti Liverpool strain were injected at the Insect Transformation Facility at the University of Maryland Institute for Bioscience and Biotechnology Research with a gene-targeting mixture composed of 300 ng/μL Cas9 protein with NLS (PNA Bio, CP01-200) and 4 sgRNAs ...
-
bioRxiv - Biophysics 2023Quote: ... ribonucleoprotein (RNP) complexes included sgRNAs targeting either N- or C-terminal region (Integrated DNA Technologies - IDT) and Cas9 protein (PNA bio, Cat #CP01) were transfected together with linear dsDNA donors (IDT ...