Labshake search
Citations for BioLegend :
1701 - 1750 of 2139 citations for Carboxypeptidase Y from Baker's Yeast since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Naive P14 Thy1.1+ Il2ra−/− cells were isolated from 4-5 week old mice by depleting CD44hi cells (Biolegend biotin anti-mouse/human CD44 ...
-
bioRxiv - Cell Biology 2023Quote: ... and T cells were isolated from the spleen using the MojoSortTM Mouse CD3 T cell Isolation Kit (Biolegend). Experiments where purified T cells were cultured for longer than 24 hours ...
-
Fine tuning of CpG spatial distribution with DNA origami for improved therapeutic cancer vaccinationbioRxiv - Synthetic Biology 2023Quote: ... CD8 OT-I cells and CD4 OT-II were isolated by MojoSort kit purchased from BioLegend (#480035, #480033) according to the manufacturer protocol ...
-
bioRxiv - Biophysics 2023Quote: ... TMB and Streptavidin conjugated to horseradish peroxidase (HRP) (Catalog 405103, Lot B167931) were from Biolegend (San Diego, CA). Pierce lactate dehydrogenase (LDH ...
-
bioRxiv - Microbiology 2023Quote: ... CD14-PE/Cy7 (clone 63D3) and CD1a-AF647 (clone HI149) were purchased from Biolegend (San Diego, CA, USA). Mouse anti-human CD11b-BB515 (clone ICRF44 ...
-
bioRxiv - Immunology 2023Quote: ... CD24 BV605 (M1/69, 101827), CD103 BV711 (2E7, 121435), MHCII APC-Cy7 (M5/114.15.2, 107628), CD206 APC (C068C2, 141708) from Biolegend, Live/Dead eFluor506 (65-0866-18) ...
-
bioRxiv - Immunology 2023Quote: Cytokines were quantified using the LEGENDplex Human CD8/NK Panel 13-plex (Cat.No # 740267 Lot B330268) from Biolegend. This is a bead-based immunoassay able to quantify the concentration of different analytes in co-culture supernatants ...
-
bioRxiv - Cancer Biology 2022Quote: ... from healthy human donor Leukopaks and expanded either on anti-CD3 coated plates (+anti-CD28/IL-2, BioLegend), or in the presence of matched donor-derived monocyte-derived dendritic cells (Wölfl and Greenberg ...
-
bioRxiv - Cell Biology 2024Quote: ... single cells were digested from skin wounds and pre-incubated with purified anti-CD16/CD32 antibody (101301, BioLegend) (1.0 μg per 106 cells in 100 μl volume ...
-
bioRxiv - Immunology 2024Quote: ... and IL-6 were measured by LEGENDplex flow-based 13-plex mouse inflammation panel kit from Biolegend (740446) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... mast cells were stained using CD117 (c-Kit)-APC or APC/Cy7 and FcεRIα-PE (all from Biolegend) at 1:200 dilution for 20 min on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... Antibodies (clones in parentheses) used for surface and intracellular staining of the following molecules were obtained from Biolegend: CD45-FITC (Clone HI30 ...
-
bioRxiv - Immunology 2024Quote: ... Half of the cryopreserved biopsies from each donor were labeled with TotalSeq-A0252 barcode sequence TGATGGCCTATTGGG (Biolegend 394603), and the other half of the cryopreserved biopsy sample was labeled with MULTI-seq lipid-tag barcode sequence CCTTGGCACCCGAGAATTCCACCACAATG66 ...
-
bioRxiv - Immunology 2024Quote: ... Half of the fresh biopsies from each donor were labeled with TotalSeq-A0251 barcode sequence GTCAACTCTTTAGCG (Biolegend 394601), and the other half of the fresh biopsy sample was labeled with MULTI-seq lipid-tag barcode sequence CCTTGGCACCCGAGAATTCCAGGAGAAGA66 ...
-
bioRxiv - Cell Biology 2023Quote: 1X Fix Concentrate from the True-Nuclear™ Transcription Factor Fixation/Permeabilization Buffer Set (BioLegend, Cat. No. 424401) was added to each sample ...
-
bioRxiv - Immunology 2023Quote: ... specific antibodies included anti-mouse CD3ε (145-2C11) and CD28 (37.51) or anti-human CD3 antibody (OKT3) and anti-human CD28 (CD28.2) (antibodies from Biolegend). For flow cytometry experiments ...
-
bioRxiv - Microbiology 2023Quote: Naïve B cells were isolated from spleens by immunomagnetic depletion using MojoSort Pan B cell Isolation Kit (Biolegend) and cultured in RPMI supplemented with L-glutamine ...
-
bioRxiv - Genetics 2022Quote: ... cKit-BV510 (104D2) and NKp44-Alexa Fluor (AF)647 (P44-8) all purchased from Biolegend (San Diego, CA), CRTH2-PE (301109 ...
-
bioRxiv - Cancer Biology 2022Quote: ... FITC), CD25 (clone PC61, APC), CD69 (clone H1.2F3, PerCP/Cy5.5) and CD44 (clone IM7, PE) (all from BioLegend) and acquired using a Cytoflex S flow cytometer (Beckman Coulter) ...
-
bioRxiv - Immunology 2022Quote: ... and bone marrow single-cell suspensions was performed by flow cytometry using fluorochrome-conjugated antibodies purchased from BioLegend, unless stated otherwise ...
-
bioRxiv - Genomics 2022Quote: Single-cell RNA sequencing (scRNAseq) libraries were prepared from viably revived BM samples using hashtag B antibodies (Biolegend) and Chromium single cell 3’V3 reagent kits (10x genomics) ...
-
bioRxiv - Immunology 2022Quote: ... The samples purified in this way from each group of recipients were then suspended in 100μL buffer and labeled with 1μg per sample of the following Total-seq A antibodies from BioLegend: TotalSeq™-A0198 anti-mouse CD127 (A7R34) ...
-
bioRxiv - Microbiology 2022Quote: ... Antibody (clone#RB6-8C5) and PerCP/Cyanine5.5 anti-mouse IL17A Antibody(clone# TC11-18H10.1) were purchased from BioLegend, Inc ...
-
bioRxiv - Immunology 2022Quote: ... Enriched LPLs from mice were stained with the following monoclonal antibodies: TCR-beta-BV510 (clone H57-597, BioLegend), CD4-BV711 (clone RMA4-5 ...
-
bioRxiv - Immunology 2022Quote: ... Cell surface staining was performed at RT for 15 minutes with a panel of antibodies purchased from Biolegend, BD Biosciences or Miltenyi (Table S13) ...
-
bioRxiv - Genomics 2023Quote: ... 500,000 cells from bulk and CD45+ enriched fraction were individually re-suspended in Cell Staining Buffer (420201, Biolegend) and blocked with 5 µL Human TruStain FcX™ (422301 ...
-
bioRxiv - Immunology 2023Quote: Listed below are the antibodies used for flow cytometric analysis of human cellsurface molecules: ①Purchased from Biolegend(USA): Anti-hCD36-PE(clone 5271).
-
bioRxiv - Immunology 2023Quote: The fluorochrome or biotin-conjugated primary antibodies used for flow cytometry and immunofluorescence microscopy were purchased from Biolegend, eBioscience ...
-
bioRxiv - Immunology 2023Quote: ... The plates were washed and detection antibodies (biotinylated mouse anti-IgG1, anti-IgG2a or anti-IgE from BioLegend) were added and incubated at room temperature for 1 hour ...
-
bioRxiv - Immunology 2023Quote: Cytokine analysis from co-culture supernatants was performed with Human CD8/NK Panel (13-plex) Cat#741065 (BioLegend) following the manufacturer’s protocol.
-
bioRxiv - Immunology 2024Quote: ... viable tdTomato+ cells from individual mice were labelled with TotalSeqTM-C anti-mouse Hashtag oligonucleotide-conjugated antibodies (Biolegend) and combined into two pools ...
-
bioRxiv - Immunology 2024Quote: ... Cells from individual samples were simultaneously stained with corresponding mouse TotalSeq-A hashtag index antibodies (Biolegend; B0301-B0308) and a FACS antibody cocktail (PDPN ...
-
bioRxiv - Immunology 2024Quote: ... PBMC T cells were isolated from healthy donor using a MojoSort human CD3 T cell isolation kit (BioLegend), and FACS-sorted to yield the Siglec-7/9− population for subsequent coculture with macrophages ...
-
bioRxiv - Neuroscience 2024Quote: ... Brain and spleen cells were stained with 1 µL from each FITC anti-mouse CD45 (Biolegend, Cat. 157214), PE anti-mouse CD11b (Biolegend ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2024Quote: CD8+ naïve T cells were isolated from spleen using Mojosort Mouse CD8 Naïve T cell isolation Kit (Biolegend) and adjusted to a concentration of 1.0×106 cells/mL ...
-
bioRxiv - Immunology 2024Quote: The following fluorophore-conjugated antibodies for flow cytometry were purchased from Biolegend (anti-CD8a Pacific Blue (53-6.7), anti-CD8a Brillant violet 605 (53-6.7) ...
-
bioRxiv - Immunology 2024Quote: ... Supernatants from PBMC culture were taken on day 5 and analysed using ELISA MAX (Biolegend, California, United States) according to manufactureŕs protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... Human recombinant fibroblast activation protein alpha and dipeptidyl peptidase IV (DPP4) were purchased from Biolegend (San Diego, CA). The single domain antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells from the remaining wells were collected and resuspended in 1mL PBS with Zombie Violet™ 1000x (BioLegend®) to exclude dead cells and analyzed by flow cytometry ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse neutrophils were purified from bone marrow cells using negative magnetic bead selection according to the manufacturer’s instructions (MojoSort, BioLegend). These neutrophils had > 90% purity and > 90% viability as determined by flow cytometry ...
-
bioRxiv - Immunology 2021Quote: ... IM7, #103208), CD62L(BV786, MEL-14, 104440), CD69(PE-Cy7, H1.2F3, #104512), CXCR3 (BV650, CXCR3-173, #126531) from BioLegend. Stained samples were acquired on the BD LSRII flow cytometry system using BD FACSDiva software ...
-
bioRxiv - Neuroscience 2021Quote: Monocytes were isolated from total PBMCs prepared as described above (Gopinath et al. 2020) using negative selection (Biolegend, 480048) per manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... frozen primary mononuclear cells from a bone marrow aspirate were thawed and stained with CD34-APC (clone 581; Biolegend), CD38-PeCy7 (clone HB7 ...
-
bioRxiv - Neuroscience 2020Quote: ... cortical cells from embryonic mice were labelled with Brilliant Violet 421™ anti-mouse CD90.2 (Thy1.2) antibody (BioLegend, #140327). Cells were incubated with antibody at 4 °C for 20 minutes followed by washing with wash buffer (Ca2+/Mg2+ free PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... BV785), GM-CSF (MP1-22E9, PE-Cy7), CD49b (DX5, PE) and CD94 (18d3, PerCP/Cy5.5) were purchased from BioLegend. Anti-Ly49I (YLI-90 ...
-
bioRxiv - Immunology 2022Quote: ... Cell surface staining was performed for 30 min at 4ºC with fluorochrome-conjugated monoclonal antibodies to mouse antigens purchased from Biolegend: CD45 (30-F11) ...
-
bioRxiv - Immunology 2022Quote: ... Brefeldin A solution (420601) and CFSE Cell Division Tracker Kit (423801) were purchased from Biolegend (San Diego, CA, USA). PE anti-mouse IL-4 (12-7041-81) ...
-
bioRxiv - Immunology 2022Quote: ... mouse TNF-α (clone MP6-XT22), mouse CD8α (clone 53-6.7), and mouse CD16/32 (Fc block, clone 93) were purchased from Biolegend. Other reagents used include Zombie Aqua Viability Dye (Biolegend) ...
-
bioRxiv - Immunology 2022Quote: ... anti-granzyme B PE (1:50; clone QA16A02) and anti-TNFα BV711 (1:50; clone MP6-XT22) from BioLegend in permeabilization buffer at 4°C for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and anti-CD49a APC (1:50; clone HMα1) and anti-CD11b BV570 (1:100; clone M1/70) from BioLegend. Cells were fixed for 30 min at 4°C using eBioscicencesTM FoxP3/Transcription factor staining buffer set (Thermo Fisher ...