Labshake search
Citations for Roche :
1 - 50 of 7633 citations for ssc mir 376a 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time RT-PCR was carried out using Real-Time PCR Master Mix (KAPA Biosystems) and following probes and primers on a 7300 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: Real-time RT-PCR analysis was performed on a LightCycler 480 Real-Time system (Roche) for 45 cycles ...
-
BTBD9 is a novel component of IGF signaling and regulates manganese-induced dopaminergic dysfunctionbioRxiv - Neuroscience 2021Quote: ... Real-time quantitative PCR (RT-qPCR) used 2×RealStar Green Fast Mixture (GenStar) with a Real-time PCR Detection System (LightCycler96, Roche). The following primers were used in the amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative RT-PCRs were run in a 7500 real-time PCR system (Roche) using the following settings ...
-
bioRxiv - Microbiology 2020Quote: ... previously published assay (“one-step real-time RT-PCR E assay”) using the One-Step RT-qPCR kit (Roche Diagnostics). For each run ...
-
bioRxiv - Neuroscience 2021Quote: ... on a LightCycler 480 Instrument II Real-Time PCR Detection System (Roche). Primer sequences are provided in the Table 1 ...
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time RT-PCR was performed with LightCycler® 480 II (Roche) using DyNAmo ColorFlash SYBR Green (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT products were amplified by real time PCR (LightCycler™ 480, Roche) using SYBR Green I Master mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT product was amplified by real-time PCR (Roche LightCycler® 480 PCR instrument) using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT product was amplified by real-time PCR (Roche LightCycler® 480 PCR instrument) using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™) ...
-
bioRxiv - Biochemistry 2022Quote: ... I analyzed samples by real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) using a Light Cycler 1.5 (Roche Diagnostics). Measurements form RNA of vascular cell adhesion molecule-1 (VCAM-1 ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative real-time PCR was performed with LightCycler 480 SYBR Green I Master detection kit (Roche 04707516001) on a Light Cycler 480 machine (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... One step real time RT-PCR was performed using the RNA Process Control Kit (Roche, Basel, Switzerland) with 5 μl of extracted RNA or directly from 5 μl of heated sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... The levels of relevant mRNAs were quantitated by real-time PCR using One Step SYBR GREEN RT-PCR Kit (Roche) in a Light Cycler instrument (Roche Applied Science ...
-
bioRxiv - Neuroscience 2019Quote: ... in a real-time quantitative PCR (qPCR) detection system (LC480, Roche, Basel, Switzerland) using the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed using the Real-Time PCR System (LightCycler 96, Roche). Each reaction comprised of 0.5 µL of diluted cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... The RT product was amplified by LightCycler 480 Real-Time PCR system (Roche) using PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative real time PCR (RT-qPCR) was performed on a LightCycler 480 (Roche). cDNAs were synthesized from 500ng of total RNA using the SuperScript™ III Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time quantitative RT– PCR was performed on a LightCycler 2.0 apparatus (Roche) using the Light Cycler FastStart DNA Master SYBERGreen I kit (Roche) ...
-
bioRxiv - Genomics 2022Quote: ... Real-time quantitative PCR (RT-qPCR) was performed using Power SYBR Green PCR master mix (Roche) to quantify the DNA recovery compared to ChIP input DNA at one embryo equivalency (percent input) ...
-
bioRxiv - Microbiology 2020Quote: Real time quantitative RT-PCR was performed with the Light Cycler RNA Master SYBR Green I kit (Roche), following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time RT-PCR of target genes were performed using KAPA SYBR FAST qPCR kit (KAPA Biosystems). Expression levels were calculated according to the relative 2−ΔΔCt method.14 All primers are listed (Supplemental Table 2S).
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time RT-PCR of target genes were performed using KAPA SYBR FAST qPCR kit (KAPA Biosystems). Expression levels were calculated according to the relative 2-ΔΔCt method.65 All primers for target genes are listed (Supplemental Table 5S).
-
bioRxiv - Plant Biology 2019Quote: ... were used as template for quantitative real time RT-PCRs which were performed in 384-well plates using a LightCycler 480 II detection system (Roche Diagnostics, Mannheim, Germany). GoTaq PCR Mastermix (Promega ...
-
bioRxiv - Cell Biology 2019Quote: ... Real-time RT PCR was performed using FastStart Universal SYBR Green Master mix (Roche). Samples were analyzed in triplicate for β2-Microglobulin (B2M) ...
-
bioRxiv - Genetics 2019Quote: ... real-time RT-PCR was performed on a LightCycler® Nano (Roche, Mannheim, Germany). The PCR reaction mixture in a 20 μl volume containing 10 μl of 2×SYBR Green PCR Master Mix (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR was performed with a LightCycler 96 Real-Time PCR System (Roche Diagnostics), using HOT FIREPol EvaGreen qPCR Mix (Solis BioDyne ...
-
bioRxiv - Neuroscience 2021Quote: ... Real-time RT-PCR was then performed on a LightCycler™ system (Roche Diagnostics) using the light Cycler-DNA Master SYBR Green I mix ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Quantitative real-time RT-PCR analysis was performed using a Lightycycler 480 (Roche, Germany). Complementary DNA (10 ng) ...
-
bioRxiv - Neuroscience 2021Quote: Real-Time polymerase chain reaction (RT-PCR) was performed using SYBR green (04887352001, Roche) on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was carried out with a LightCycler 480 Real-Time PCR System (Roche) using primers listed in Supplementary Table 2 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... RT-qPCR was performed with The Light cycle 96 Real-Time PCR System (Roche). The PCR-program ...
-
bioRxiv - Biochemistry 2023Quote: ... The RT product was amplified using the LightCycler 480 Real-Time PCR system (Roche) using PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... for real-time quantitative PCR (RT-qPCR) in a LightCycler®480 System (Roche). The following primers were used for determination of intracellular ZIKV genomes (fwd 5’ agatcccggctgaaacactg 3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... Real-time PCR was performed on a LightCycler 480 real-time PCR system (Roche) combined with the LightCycler 480 SYBR Green I master mix (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was conducted on Roche Lightcycler 96 Real time PCR system (Roche) with FastStart Essential DNA Green Master (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed on a Real-time system (Roche) using SYBR green supermix (Vazyme) ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed using a One-step BrightGreen RT-qPCR Kit (Abm, G471-S) following the manufacturer’s protocol in the LightCycler 96 Real-Time PCR System (Roche). Isocitrate dehydrogenase (ICDH ...
-
bioRxiv - Genetics 2021Quote: ... was used for quantitative real-time PCR (RT-qPCR) analysis with a LightCycler 480 (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Real-time RT-PCR was done using the LightCycler™ 480 system (Roche Applied Science). Samples were normalised to ornithine decarboxylase (odc ...
-
bioRxiv - Plant Biology 2020Quote: ... The RT-qPCR was carried out on a LightCycler 480 Real-Time PCR System (Roche). Three independent biological replicates of each condition and at least two technical replicates of each biological replicate were performed ...
-
bioRxiv - Genetics 2023Quote: ... The RT-qPCR assay was carried out in a LightCycler480 Real Time PCR system (Roche) using the TaqMan gene expression assay ...
-
bioRxiv - Physiology 2023Quote: ... Real-time quantitative polymerase chain reaction (RT-qPCR) was carried out in a LightCycler 480 detection system (Roche) using the LightCycler FastStart DNA Master plus SYBR Green I kit (Roche) ...
-
bioRxiv - Microbiology 2019Quote: One-step simplex real-time quantitative RT-PCR amplifications were performed using Multiplex RNA Virus Master Kit (Roche Diagnostics, France) for influenza A ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (Biolaps) according to the manufacturer protocol on a LightCycler real-time PCR thermocycler (Roche). The analysis of the infection rate based on PCR data was done with the binGroup package [42] in R software.
-
bioRxiv - Neuroscience 2023Quote: Real-time PCR analysis was performed with use of LightCycler 96 real-time PCR system (Roche). The PCR parameters were following ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR analysis was performed using a LightCycler® 96 Real-Time PCR System (Roche). Primers were designed for each gene with Primer3-0.4.0 software (http://bioinfo.ut.ee/primer3-0.4.0/) ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time PCR analysis was performed using a LightCycler® 96 Real-Time PCR System (Roche). RT-qPCR reaction was prepared in triplicates by mixing 2.5 μl of a 25-fold diluted cDNA ...
-
bioRxiv - Physiology 2020Quote: ... Real-time PCR (LightCycler 480; Roche) was performed with diluted cDNAs in a 20-μl reaction volume in triplicate.