Labshake search
Citations for Roche :
651 - 700 of 7604 citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 2 μl of 1:25 diluted cDNA with water was used for real-time PCR (LightCycler 480 Roche) using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was carried out using a KAPA SYBR FAST qPCR Master Mix 2X (Kapa Biosystems, USA), a qTOWER3 G touch (Analytik Jena AG ...
-
bioRxiv - Cell Biology 2022Quote: ... The resultant cDNA was subjected to real-time PCR analysis in a LightCycler 480 or LC96 instrument (Roche) with Thunderbird SYBR qPCR mix (Toyobo ...
-
bioRxiv - Genomics 2023Quote: ... and analyzed on a light cycler rapid thermal system (LightCycler®480 2.0 Real time PCR system, Roche). ChIP-qPCR results were normalized on input signal (% input) ...
-
bioRxiv - Neuroscience 2024Quote: ... SYBR Green (PB20.11-05, PCR Biosystems) was used on a real-time thermal cycler (LightCycler® 480, Roche). S16 or HPRT were used as internal control gene ...
-
bioRxiv - Cell Biology 2024Quote: All qPCR reactions were performed with a LightCyler 1.3 Real-Time PCR system (Roche S/N: 140 6143). The MgCl2 concentration (1-3 mM ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was analysed by real-time PCR with the Light Cycler 480 SYBR Green I Master Mix (Roche). A set of 3 household genes has been used to normalize (Cyclophilin ...
-
bioRxiv - Genetics 2023Quote: ... mRNA expression was then analyzed by real-time PCR using KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems) and the CFX-96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) ...
-
bioRxiv - Genetics 2022Quote: ... q-PCR was carried out using the PCR Biosystems Sygreen Blue Mix Separat -ROX (Cat. No. 17-507DB) in a LightCycler 480 Real-Time PCR system (Roche Diagnostics Corp., IN). Quantification was performed using the comparative ΔΔCt method and normalization for internal reference was done using either act-5 or pmp-2 ...
-
bioRxiv - Cancer Biology 2023Quote: Real-time quantitative PCR (qPCR) was performed in accordance with MIQE-guidelines (15) using a LightCycler® 480 Real-Time PCR Instrument (Roche, Mannheim, Germany) in a 384-well plate format ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was used to reverse-transcribe ligated products and KAPA Real-Time Library Amplification Kit (Roche) was used for cDNA amplification ...
-
bioRxiv - Microbiology 2021Quote: ... on a LightCycler 96 real-time thermocycler (Roche) following a published method [52 ...
-
bioRxiv - Microbiology 2022Quote: ... and vRNA were generated by reverse-transcription PCR (RT-PCR) using Transcriptor First Strand cDNA Synthesis Kit (Roche). Primers with specific tags for differentiations of virus mRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR was achieved using 2X Faststart PCR mastermix (Roche) using primer sets and cycling conditions described in Supplementary Table 1 ...
-
bioRxiv - Genetics 2021Quote: ... Real-time quantitative PCR (qPCR) was performed using SYBR Green Master Mix and the LightCycler® 480 instrument (Roche). Relative levels of gene expression were analyzed using the 2ΔΔCt method and compared to the expression of the human housekeeping gene PPIB ...
-
bioRxiv - Genetics 2021Quote: ... Real-time quantitative PCR (qPCR) was performed using SYBR Green Master Mix and the LightCycler® 480 instrument (Roche). Relative levels of gene expression were analyzed using the 2ΔΔCt method and compared to the expression of the human housekeeping gene PPIB ...
-
bioRxiv - Molecular Biology 2019Quote: ... The reaction was carried out on a LightCycler® 96 Real-Time PCR system (Roche Applied Science, Indianapolis, USA). Internal control was the GAPDH gene while the 2-ΔΔCT method was used to assess expression ...
-
bioRxiv - Immunology 2019Quote: ... Amplification of cDNAs was performed by quantitative real-time PCR reactions on a Light Cycler instrument (LC480, Roche Diagnostics) with the Light Cycler 480 SYBR Green detection kit (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2019Quote: ... QPCR was performed on a 7900HT Fast Real-Time PCR System (Thermofischer) with SYBR green reagent (Roche, Cat#04707516001). The Rps9 cDNA was used for data normalization ...
-
bioRxiv - Genomics 2019Quote: ... Gene expression was measured by quantitative Real Time - Polymerase Chain Reaction (qRT-PCR) (LightCycler 480, Roche Diagnostics, Basel, Switzerland) using the SYBR Premix Ex Taq (Tli RNaseH ...
-
bioRxiv - Microbiology 2019Quote: Each real-time PCR reaction contained 1x Roche universal probe library (UPL) master mix (LightCycler 480 Probes Master, Roche), 80 nM UPL hydrolysis probe ...
-
bioRxiv - Microbiology 2021Quote: ... The quantity of the libraries was measured by real-time PCR using the LightCycler® 480 Instrument II (Roche) and QIAseq™ Library Quant Assay Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2021Quote: ... The thermal melting curve were monitored using a LightCycler 480 II Real-Time PCR System (Roche Diagnostics, Rotkreuz, Switzerland) with a ramp rate of 1 °C at the temperature range from 25 °C to 98 °C ...
-
bioRxiv - Cell Biology 2021Quote: Real-time PCR was performed using the LightCycler 480 SYBR Green and LightCycler 480 system (Roche Diagnostics, Mannheim, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... the semi-nested real-time q-PCR reactions (LightCycler 480 II, Roche Life Science, Roche Diagnostics Corporation, IN, USA) were performed with 1:5-diluted 1st PCR product ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were set up according to the manufacturer’s protocol and run on a LightCycler 96 real-time PCR machine (Roche). The cycling parameters were ...
-
bioRxiv - Microbiology 2021Quote: ... and all reactions were set up according to manufacturer’s protocols on a LightCycler 96-well real-time PCR machine (Roche). The following cycling parameters were employed ...
-
bioRxiv - Microbiology 2020Quote: DNA was used as a template for the real-time PCR amplification using a LightCycler Nano instrument (Roche diagnostics), Fast Start Essential DNA Green Master Green (Roche diagnostics ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s protocol and amplification was quantified on an LightCycler 480 II Real-Time PCR System (Roche). In all cases ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantified Real-time PCR (qPCR) analyses were carried out using the FastStart Essential DNA Green Master (Roche, Swiss Confederation) as instructed by the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... real-time monitoring of PCR amplification of cDNA with FastStart Universal SYBR Green Master (Roche Applied Science, Indianapolis, IN) in an ABI Prism 7900 Sequence Detection System (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time monitoring of PCR amplification of cDNA was carried out using FastStart Universal SYBR Green Master (Rox, Roche). The primers used for gene expression are ...
-
bioRxiv - Molecular Biology 2021Quote: Telomere lengths from obtained DNA samples were determined in a quantitative real-time Light Cycler 480 PCR (Roche, Germany) device using appropriate primers (Tel F:CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGT and Tel R:GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT ...
-
bioRxiv - Biochemistry 2021Quote: ... A small fraction of the cDNA and input were allocated to real-time PCR quantification using a LightCycler 2.0 (Roche); the remainder was amplified by PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time quantitative PCR (qPCR) reactions were performed in duplicate with the FS Universal SYBR Green Master (4913914001, Roche) and run on the iCycler MyiQ2 Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Amount of the different mRNAs were determined by quantitative real-time PCR using the Universal ProbeLibrary (Roche, Life Science) and LightCycler 480 Probes Master (Roche ...
-
bioRxiv - Genetics 2020Quote: ... The DNA concentration of the library was determined using the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland) with KAPA Library Quantification Kit (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Three parallel measurements were performed with each sample in a LightCycler® 96 real-time PCR instrument (Roche, Switzerland). Relative transcription levels (ΔΔCP value ...
-
bioRxiv - Molecular Biology 2022Quote: ... Half of the reverse transcription reaction was used for amplification with a KAP real-time PCR mixture (KAPA Biosystems) using the Illumina Truseq small RNA library amplification kit primers ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was mixed with the respective primer pairs and SyGreen Blue Mix (PCR Biosystems) following the manufacturer’s protocol in biological triplicate and performed using a LightCycler 96 real-time PCR machine (Roche). Quantification cycle values were normalized to a reference gene (GAPDH ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µl of cDNA were used for Real-Time PCR with self-designed primers and SYBR green reaction (Roche). qRT-PCR reactions were performed in duplicates including non-template controls on a QuantStudio 3 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2023Quote: ... Amplification reactions were performed in duplicate using a LightCycler 96 Real-Time PCR system (Roche Molecular Systems, CA, USA), and fluorescence curves were analyzed using this software ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of OsHV-1 and total bacteria were performed using quantitative PCR (qPCR, Roche LightCycler 480 Real-Time thermocycler) with the following program ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR was performed in 384-well plates with FastStart Universal SYBR Green Master Mix (04913914001, Roche) on QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Biophysics 2024Quote: ... A small fraction of the cDNA and input were allocated to real-time PCR quantification using a LightCycler 2.0 (Roche); the remainder was amplified by PCR ...
-
bioRxiv - Zoology 2020Quote: A first strand cDNA Synthesis Kit for rt-PCR (Roche Diagnostics GmbH, Mannheim, Germany) was used for first-strand cDNA synthesis of the RNA pooled from different developmental stages of Spadella cephaloptera ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... real-time quantitative polymerase chain reaction (qPCR) (KAPA Library Quantification Kit; Kapa Biosystems, Wilmington, MA, USA), and small-scale sequencing (2 x146bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... NIH 3T3 cells were counted and then lysed using Real time ready cell lysis kit (Roche). cDNA synthesis for miRNA was done with the miRCURY LNA RT kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was performed using SybrGreen (Roche) on a Roch480II Lightcycler using the following primers ...
-
bioRxiv - Genetics 2020Quote: ... with SYBR Green RT-PCR (Roche, #4913914001). Melting curve analysis was performed for each primer set to ensure the specificity of the amplified product and with an efficiency of 2 ...