Labshake search
Citations for Roche :
151 - 200 of 3664 citations for rno mir 194 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: Transcript levels were assessed by quantitative RT-PCR using a LightCycler 480 system (Roche), as described by Gutierrez et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Quantitative real-time RT-PCR analysis was performed using a Lightycycler 480 (Roche, Germany). Complementary DNA (10 ng) ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 infection was confirmed by the RT-PCR-COBAS 6800 System (Roche Molecular Systems ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ChIPed DNA was subjected to RT-PCR using a SYBR Green Master Mix (Roche) using the following oligonucleotides ...
-
bioRxiv - Developmental Biology 2019Quote: ... Quantitative RT-PCR was performed by amplification with Lightcycler 480 SYBR green Master (Roche). The primers used are listed in Table 1 ...
-
bioRxiv - Neuroscience 2021Quote: Real-Time polymerase chain reaction (RT-PCR) was performed using SYBR green (04887352001, Roche) on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR was performed using a LightCycler 480 machine (Roche, software version 1.5.1.62), primers and probe specific for SARS-CoV-2 RdRP (TibMolBiol ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was carried out with a LightCycler 480 Real-Time PCR System (Roche) using primers listed in Supplementary Table 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... Q-RT-PCR reactions used Lightcycler 480 SYBR Green I Master Mix (Roche 04707516001) on a Roche Lightcycler 480 ...
-
bioRxiv - Neuroscience 2022Quote: ... and then quantitative RT-PCR was performed with FastStart Universal SYBR Green Master (Roche). The relative standard curve method was used to obtain the relative quantities of Oxtr expression following the manual of Applied Biosystems ...
-
bioRxiv - Physiology 2023Quote: ... Quantitative RT-PCR was performed on a Light Cycler 480 System (Roche Life Science) with the following conditions ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... RT-qPCR was performed with The Light cycle 96 Real-Time PCR System (Roche). The PCR-program ...
-
bioRxiv - Biochemistry 2023Quote: ... The RT product was amplified using the LightCycler 480 Real-Time PCR system (Roche) using PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... for real-time quantitative PCR (RT-qPCR) in a LightCycler®480 System (Roche). The following primers were used for determination of intracellular ZIKV genomes (fwd 5’ agatcccggctgaaacactg 3’ ...
-
bioRxiv - Immunology 2020Quote: ... Knockdown of A3A is confirmed by RT-qPCR using allele-specific primers and SDHB probe on a Light Cycler 480 System (Roche), as previously described (Baysal et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative RT-PCR was conducted in Roche Applied Science LightCycler 480II Real-time PCR systems (Roche Applied Science, Indianapolis, IN, USA) in accordance to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... One step real time RT-PCR was performed using 100 ng of total RNA and KAPA SYBR FAST One-Step qRT-PCR Kits (Kapa Biosystems) according to the directions provided by the manufacturer ...
-
bioRxiv - Immunology 2019Quote: ... and then PCR amplified using Nextera primers with 2x HiFi Polymerase Master Mix (KAPA Biosystems). Amplified ...
-
bioRxiv - Cell Biology 2019Quote: ... probes were prepared by using specific primers (Table 2b) using DIG labeling PCR kit (ROCHE). DIG labeled PCR products were purified using the nucleospin gel and PCR cleanup kit (Macherey ‒Nagel).
-
bioRxiv - Neuroscience 2020Quote: ... and primers listed in Supplementary Table 1 on LightCycler® 480 PCR instrument II (Roche). Primer efficiencies were determined by serial dilutions of input samples and were used for analysing the results ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and the synthesized primers for qRT-PCR and KAPA SYBR Fast qPCR Kit (KAPA BIOSYSTEMS) were used to perform qRT-PCR with StepOnePlus (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... a 710 bp region was amplified by PCR using previously described primers (45) and the KAPA HiFi HotStart ReadyMix PCR Kit (Roche, Basel, Switzerland) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated from 1.0 μg of RNA using TaqMan Reverse Transcription (RT) Reagents and random hexamer primers (Roche, cat#N8080234). Equal volumes of cDNA were used for quantitative PCR (qPCR ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR primers (Table S1 and Table S2) were designed using the Universal Probe Library Assay Design Centre (Roche Life Sciences) and primer efficiency was determined using pooled cDNA samples ...
-
bioRxiv - Plant Biology 2022Quote: ... RT was performed with 5 µg of total mRNA using Transcriptor Reverse Transcriptase and oligo (dT)15 primer (Roche, Mannheim, Germany). QRT-PCR was run on a LightCycler 480 (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... Reverse Transcription quantitative PCR (RT-qPCR) analysis was performed using a LightCycler 480 system (Roche) and the SYBR Green I Master mix (Roche) ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-PCR was performed at a 384 well format on the 480 Lightcycler instrument (Roche) using KAPA SYBR FAST qPCR KIT (Kapa Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... quantitative RT-PCR was performed using KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems) on a LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Genetics 2021Quote: ... was used for quantitative real-time PCR (RT-qPCR) analysis with a LightCycler 480 (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Real-time RT-PCR was done using the LightCycler™ 480 system (Roche Applied Science). Samples were normalised to ornithine decarboxylase (odc ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using a LightCycler 480 SYBR Green I Master Mix (Roche) as per manufacturer’s instructions in 96-well plates and conducted in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-PCR was performed in duplicates using LightCycler® 480 II (Roche Life Science, Germany) and the average values of both the experiments were used for the analysis ...
-
bioRxiv - Cell Biology 2019Quote: ... and gene expression was determined by SYBR-green RT-PCR on the Lightcycler 480 (Roche). Gene expression was normalised to GAPDH and analysed using the ΔΔCt method ...
-
bioRxiv - Plant Biology 2020Quote: ... The RT-qPCR was carried out on a LightCycler 480 Real-Time PCR System (Roche). Three independent biological replicates of each condition and at least two technical replicates of each biological replicate were performed ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative RT-PCR was performed using a LightCycler 480 SYBR Green I Master Mix (Roche) as per manufacturer’s instructions in 96-well plates and conducted in a LightCycler 480 Instrument II (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR reactions were performed with a LightCycler® 480 (Roche Diagnostics, Meylan, France) using Power SYBR® Green Master Mix (Roche ...
-
bioRxiv - Genetics 2020Quote: ... RT-quantitative PCR was carried out using LightCycler 480 SYBR green I master chemistry (Roche). All samples were measured in triplicates ...
-
bioRxiv - Molecular Biology 2022Quote: Real-time RT-PCR analysis was performed on a LightCycler 480 Real-Time system (Roche) for 45 cycles ...
-
bioRxiv - Genetics 2023Quote: ... The RT-qPCR assay was carried out in a LightCycler480 Real Time PCR system (Roche) using the TaqMan gene expression assay ...
-
bioRxiv - Pathology 2022Quote: ... Expression of mtDNA encoded genes were determined by quantitative real-time RT-PCR using SYBR Green PCR Master Mix (Roche Applied Science). The primers were listed as followed.
-
bioRxiv - Microbiology 2023Quote: ... Respiratory viruses were detected from specimens by real-time PCR and reverse transcription (RT)-PCR assays with LightCycler instruments (Roche, Basel, Switzerland) as previously described (22 ...
-
bioRxiv - Genomics 2019Quote: ... 20 μl PCR reactions were set up in 96 well plates using 1U FastStart high fidelity polymerase (Roche, 3553361001), 2 μl of extracted gDNA as template ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were set up according to the manufacturer’s protocol and run on a LightCycler 96 real-time PCR machine (Roche). The cycling parameters were ...
-
bioRxiv - Microbiology 2021Quote: ... and all reactions were set up according to manufacturer’s protocols on a LightCycler 96-well real-time PCR machine (Roche). The following cycling parameters were employed ...
-
bioRxiv - Microbiology 2022Quote: ... DNA probes were synthesised using the designed primers followed by PCR DIG-probe Synthesis kit (Roche) according to the manufacturer’s instructions in 50μl reaction volumes ...
-
bioRxiv - Cancer Biology 2019Quote: ... The primers used for real-time PCR were designed based on the Universal Probe Library (Roche, Roche Life Science ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was performed using specific primers and the LightCycler 480 SYBR Green I (#04887352001, Roche) on a LightCycler 480 (Roche) ...
-
bioRxiv - Pathology 2021Quote: ... A quantitative real time polymerase chain reaction (q-RT-PCR) was used to quantify the parasite load by using PCR SYBER Green Master Mix (Roche, Applied Science, CT) containing MgCl2 by employing QuantStudio 3 Real-Time PCR system (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Real-time quantitative RT-PCR (Q-PCR) was performed in 384-well plates using the LightCycler® Multiplex DNA Master (Roche Life Sciences) and hybridization probes from the Universal Probe Library Set (Roche Life Sciences) ...